SWINE FLU and STEM CELL and DNA

Can You Change Your Dna?

2012-02-02T19:51:00.001-08:00

If you have ever wondered whether you can change your DNA, the basic answer is no. However, it's more complicated than that. DNA can be changed and it does change all the time, but we cannot currently change our own, or have any procedures carried out to have it changed by scientists for us.

A Complicated Issue

There are lots of companies out there that are taking advantage of the notion that we can change our DNA. The truth of the matter is, however, complex. Human DNA does change. Our bodies adjust the nucleotide sequence of DNA naturally, in order for the human species, or indeed any species to evolve.
When cells in our bodies divide, the DNA is copied across but polymerase doesn't always copy it exactly. Sometimes polymerase copies the sequence of nucleotide bases and gets it wrong, for example taking ATCATAGC and creating ATGATAGC. These subtle changes are usually harmless.

Most of the time, these mutations don't have any noticeable effect on our bodies and they occur outside of a coding region, or are similar enough changes to the original DNA to not affect the amino acid sequence. The changes that matter, however, stop the gene from actually doing anything or change its function and those changes are dangerous.

There are techniques in existence which deliberately use DNA polymerase to introduce changes to DNA, in the hope of provoking mutagenesis, however these are all tests conducted in labs. To date, there is little to no research into changing DNA within or for a living person. There are several reasons why altering a living person's DNA is not presently something we can do or would be willing to do. Some of these reasons are ethical, while others are scientific.

Ethical Considerations

Scientifically any potentially dangerous testing on human beings is unethical which makes gene therapy and other DNA related tests and procedures impractical. They are largely considered unthinkable at present and DNA related experiments such as cloning have been tested on animals (famously Dolly the sheep) but are not conducted on human beings.

Scientific Limitations

All of the work on human DNA has been carried out on cells in laboratories, not inside living people and it is entirely infeasible to change the DNA of a live human being using the techniques we've described. Therefore, science has not progressed sufficiently to alter the DNA of living people.

Quack Science

A number of companies claim that it's possible to change your DNA with emotional therapies, mind training and other courses of behaviour but this is false. There is nothing you can do with positive thinking or mental exercises to change your DNA. At best all you can achieve through such pursuits is a happier attitude or a healthier brain because that is the organ you use for meditation or mind training.

Therefore, if a company claims that they can change the DNA within your body to solve your problems, sadly they are deceptive, dangerous, deluded or all three of these.

Stem Cells Controversy

2012-02-02T19:49:00.001-08:00

Both sides of the stem cells controversy are passionate about defending their positions. Before discussing stem cell research pros and cons it is important to understand the different types of stem cells and where they come from. Stem cells can come from three different sources. One source is from the bone marrow, peripheral blood vessels, or tissue of a person. Stem cells are even found in the heart and brain. The second source of stem cells is an umbilical cord. The third source is from a fertilized human egg. This last source is one of the most hotly debated parts of the stem cells controversy.

The pros of stem cell research include the possibility of curing devastating diseases or conditions like Parkinson’s, heart disease, stroke, diabetes, and genetic defects. Proponents believe that stem cells can repair a damaged spinal cord or brain. There would be little risk of rejection if a transplanted organ came from the person’s own stem cells. Stem cells are thought to play an important role in cancer. Skin stem cell research will most likely result in the ability to regenerate skin and hair.

Arguments against stem cell research tend to have a more religious basis. On the con side of the stem cells controversy people are afraid that eventually we will be cloning humans, that we are acting like God, and that we are tinkering in areas where we have not fully considered the scientific, ethical and moral consequences. The most heated part of the stem cells controversy has to do with the destruction of a fertilized egg in order to harvest the cells. The cells often come from eggs that were fertilized in the laboratory for in vitro fertilization, but are now no longer needed. Some people see this as destroying a human life, even though that fertilized egg will never be implanted and grow into a person.

Top 10 Benefits of Skin Stem Cell Research

2012-02-02T19:47:00.000-08:00

Scientists from one of the leading USA Universities reported a major breakthrough in the skin stem cell research in February of 2008 by discovering how to reprogram adult skin cells into cells with very similar properties of mesenchymal stem cells. These new stem cells offer a variety of skin stem cell research benefits and are going to take science into a new level of finding cures for thousands of incurable diseases.

Let’s review some of the benefits skin stem cell research can bring along in the future:

1. Skin stem cell research can turn adult skin cells into cells with miraculous embryonic stem cells properties without the moral disadvantages of destroying embryos in order to harvest such cells.

2. Newly reprogrammed stem cells can be coaxed to produce a bio-compatible organ or tissue virtually eliminating the possibility of transplant rejection by the host and necessity for the dangerous immune suppressant therapy that used to be necessary before skin stem cell research breakthrough.

3. Pros of stem cell research based on new findings finally outweigh the cons associated with using and later destroying a human embryo to harvest embryonic stem cells that are also short in supply. The newly reprogrammed adult stem cells provide abundant and ready available supply of mesenchymal stem cells to start saving lives.

4. Adult skin stem cell research is believed to have more predictable results due to the whole process being carried out in a more controllable environment compared to the embryonic stem cells, that some scientists consider unstable and potentially resulting in tumors.

5. Skin stem cell research along with umbilical cord stem cell therapy options are more likely to gain more public approval and attract more federal and private funding than embryonic stem cell research with its moral dilemma.

6. Not only new skin stem cell research eliminates the needs to destroy a human embryo, the process of obtaining new stem cells is more efficient and cost effective.

7. Since the new skin stem cell research offers opportunities to produce cells very close in the nature to the embryonic stem cells, this can become a solution to treat various dangerous diseases like diabetes, for example, by injecting a patient with newly programmed islet cells that can eventually start producing patient’s own insulin and eliminate the need for day to day glucose testing and insulin therapy.

8. New stem cell treatment for heart disease can also provide hope for thousands of people with heart conditions waiting on a donor list for an implant. Their own skin stem cells could be harvested to grow a new heart or its part to replace their failing ones.

9. Spinal cord injuries are another group of disabling conditions that can be repaired with the help of newly reprogrammed adult skin cells and enable people to start walking again.

10. Alzheimer’s, Parkinson’s diseases, brain injuries, strokes are just a few medical problems that can be amended by using skin stem cell research to grow new neuron cells necessary to cure such maladies.

The new skin stem cell research findings might still sound like a piece from your favorite sci-fi novel but it gives us hope that sometime in the future we can simply grow a replacement for a faulty organ, bone, muscle or tissue and go on enjoying our precious life again.

Top 10 Ways of Using Umbilical Cord Stem Cell Transplants

2012-02-02T19:45:00.001-08:00

Umbilical cord blood is usually drawn from the umbilical cord after it had been detached from the newborn baby not causing any harm to the baby or mother. It’s believed to contain so called pure blood stem cells without the blood markers or antigens that can potentially be rejected by the recipient’s immune system. Extracted cord blood is then placed to a blood bank and frozen until future use. When the need arises, the umbilical cord blood stem cells are then injected intravenously into a patient’s blood stream to repair any damaged organ or tissue and create new and healthy cells.

The low cost, ease of extraction and lack of antigens in the umbilical cord blood makes it a unique way to be used for umbilical cord stem cell transplant therapy. Umbilical cord blood contains mesenchymal stem cells that are considered multipotent or are able to differentiate themselves into any tissue, bone, muscle or skin, and therefore be used to treat virtually any disease in the future. In addition, umbilical cord stem cell therapy does not raise a lot of controversy as with embryonic stem cell research, which some consider to be inhumane and murderous.

Umbilical cord stem cell transplant therapy promises to cure the following deadly diseases and conditions:

1. Type 1 diabetes is believed to be potentially cured by umbilical cord stem cell injection and help stimulate own insulin production.

2. Heart diseases and conditions, repairs to heart valves and tissues could benefit from umbilical cord stem cell therapies.

3. Injuries to the brain caused by trauma or stroke.

4. Cerebral palsy in children resulting from an injury during birth.

5. Umbilical cord stem cell transplants can treat bone marrow cancer or leukemia.

6. Variety of blood cell disorders like sickle cell anemia and others.

7. Metabolic system disorders.

8. Immunodeficiency conditions.

9. Spinal and neck cord injuries.

10. Osteopetrosis or a disease of hardening bones and formation of excessive bone mass.

With the expansion of umbilical cord stem cell therapy and President Obama lifting a ban on the stem cell lab work, stem cell research pros and cons are likely to continue gaining a lot of public attention in hope to finally find a cure for hundreds of deadly diseases.

Stem Cell Therapy – Top 10 Benefits For Mankind!

2012-02-02T19:43:00.000-08:00

Within the last few years scientists focusing their work on stem cell therapy have accomplished greater progress by switching from studying controversial embryonic stem cell benefits to adult stem cell therapy and therapies involving umbilical cord stem cell samples received via cord blood banking process. According to their findings, adult stem cell therapy treatments have less chances of being rejected by a patient, therefore increasing his recovery rates. When using patient’s own skin stem cells, there’s no need to administer immune suppressing drugs as in instances of using embryonic stem cell therapy, which could be debilitating for the patient in the long run. In addition, adult stem cells are easier and less controversial to obtain, making this stem cell therapy a very promising medical field of research for the future. Let’s take a look at the top 10 benefits of adult stem cell therapy for mankind.
1. Anti-aging benefits of stem cell therapy is ability to live longer and enjoy life at the fullest even in your 80’s and 90’s. Stem cell injections could be your fountain of youth by restoring your organs, tissues and systems that get worn out over time as we age. No more saggy skin, achy joints, poor eyesight and weak heart, you can rejuvenate yourself and look and feel younger.

2. Diabetes benefits could be accomplished by injecting a patient with stem cells that have a potential to produce new islet insulin producing cells, therefore ending the need for blood glucose monitoring and insulin injections. Stem cell diabetes treatment focuses on newly diagnosed diabetes patients with poorly but still functioning pancreas to encourage its cure with stem cell therapy.

3. Transplantology benefits are numerous for people who have been waiting for years to find a suitable donor. With stem cell therapy there’s a potential to coax stem cells to grow into a new tissue or organ that is biocompatible to the transplant receiver virtually eliminating chances of organ rejection. The stem cell transplant taken from a patient’s own body called an autologous stem cell transplant can help people cure many deadly illnesses like myeloma and start living the life to the fullest.

4. Stem cell hair regrowth is a very promising field of medical science that will end hair loss struggle for male and female patients alike. Though, hair stem cell therapy is not very common at this point, the general theory suggests that in the future skin cell stems will be harvested from a patient’s hair producing follicles, implanted in bald areas and coaxed to produce new hair growing follicles, thus creating new hair growth.

5. Spinal cord injuries stem cell therapy is a very promising field of research that can help many para- and quadriplegic patients who are wheelchair bound and help them start walking again. Patients’ own stem cells harvested from bone marrow or other areas can be concentrated in a lab setting and later re-introduced into patients’ bodies in hopes to repair spinal cord tissues and restore mobility.

6. Stem cell for treating senile dementia and Alzheimer’s is one of the future benefits that this type of research can bring about. Though, the stem cell treatment to repair faulty neuron cells is still in the research phase, millions of Alzheimer’s sufferers can potentially get full of partial relief, or at least slow down the progression of this serious condition that brings so much pain to patients and their families.

7. Growing limbs for amputation patients is still a little farfetched and might not sound realistic but currently there’s a clinical trial going on at the University of Utah that focuses on using stem cell injections into patients with advanced vascular disease who are at a high risk of amputation. These stem cells can virtually create new and healthy blood vessels and save patients from the need of undergoing limb amputations.

8. Arthritis stem cell therapy is a huge benefit to humanity as currently there are over 40 million arthritis patients only in the US. Arthritis stem cell treatment can restore joint tissue by producing healthy joint tissue cells and end painful and debilitating condition.

9. Heart disease stem cell therapy is a revolutionary approach to treat a multitude of heart conditions ranging from congestive heart failure, cardiomyopathy and other heart related diseases. The theory behind this treatment is harvesting mesenchymal stem cell from a patient’s own bone marrow and differentiating them to form new heart cells that are later placed into a patient’s heart to promote heart tissue repair.

10. Autism stem cell therapy is a godsend for millions of parents struggling to find a cure for their children. Stem cells injections are currently used to repair affected parts of the brain cells in countries like China and Mexico. While the stem cell therapy for autism is not commonly practiced in the US, the scientific research is widely conducted. Autism stem cell treatment should work on re-growing new and repairing existing cells of the gray and white matter of the brain.

Top 10 Swine Flu Side Effects

2012-02-02T19:42:00.001-08:00

Swine flu side effects have been known to lead to serious complication which is why the swine flu panic has caused so much concern over the past few years. Whether a cough, sore throat, weakness, body aches, or fever, the swine flu side effects include similar symptoms of other influenza. However, swine flu side effects can be more intensive which will lead to deeper, more life threatening issues causing hospitalization, and sometimes even death.

The following are the top ten swine flu side effects:

1. For an expectant mother, the swine flu and pregnancy can possibly lead to a hospitalization due to various complications which include lung disease and pneumonia.

2. The swine flu side effects for children are also life threatening. Children suffering from the swine flu have an increased possibility of developing seizures due to the potential neurologic involvement of the disease.

3. With pneumonia being a common swine flu side effect, the need for oxygenation is increased for those suffering from severe cases of the disease.

4. Vomiting, diarrhea, and other gastrointestinal problems associated with the swine flu will be the culprit of more serious issues like dehydration, which will have an effect on heart health and the circulatory system.

5. Kidney and urinary function is compromised when gastrointestinal issues like vomiting and diarrhea cause dehydration.

6. Due to the body’s natural disease combating potential, the immune system which is put into overdrive is highly affected by the swine flu.

7. Those with hypertension, or high blood pressure, are at risk when fever and dehydration is present as a result of a swine flu side effect. This will jeopardize one’s mortality, especially in the elderly suffering from the disease.

8. Children under 5 years of age, the elderly over 65, pregnant women, and others with various health issues are most at risk for suffering from swine flu side effects.

9. Those with asthma conditions, blood or liver disorders, neurological conditions, metabolic issues like diabetes, and neuromuscular disorders should take extra precautions against the threat of contracting the swine flu.

10. Disinfect home and work surroundings when illness seems to be creeping its way through family members or coworkers. Countertops, bathrooms, utensils, toys, remote controls, computer keyboards, and more are perfect surfaces where flu germs will find their next victim.

The Dna Testing Process

2012-01-03T05:57:00.000-08:00

DNA testing is becoming increasingly used to determine genetic links between individuals as a highly accurate and individual way of identifying people and their relationships with one another. The process itself is one carried out in advanced laboratories under the strictest of lab conditions to ensure no cross-contamination and improve result accuracy. As such DNA testing can be said to present with a high degree of accuracy any particular biological relationship that may exist, particularly in paternity disputes where samples of both the mother and the father are provided.

Preparing For the DNA Test and Collecting Samples
Normally a DNA testing kit is sent to the person who ordered the test by the company from whom the order was made. The test begins with samples being collected from everyone preparing to undertake the test. In most cases, that will mean the mother, the father (alleged) and the child concerned. Samples are taken by the way of oral swabs, which collect cheek cells which are then dried and passed on for testing. In order to prepare the sample, it is first important to make sure that the cotton of the swab never touches any other surface including your hands, and that you have a number of swabs for each person taking the test to ensure reliability in the end results. Press the swab into the inside of the cheek and behind the lips, as well as the tongue area in order to get as good as possible a sample from the mouth. Having left to dry for around an hour, the swab should be carefully sealed off before the collation and mailing process.

Testing the Samples
After all the samples have been collected and labelled accordingly, they should be sent off to the laboratory for the DNA testing analysis. At this stage, the samples will be individually examined and DNA will be extracted from within the cells present in the sample. The same will be done for both the other two parties to the test and the results of the DNA profiles will be compared.

The person analysing your results will be looking for a 50/50 split between your alleles, contained within the DNA, between those found on your mother and father. As you can only inherit genes already carried by one or both parents, no alleles can be present in the child's DNA that are not present in that of either parent. Naturally, this is where it becomes obvious when there is and is not a genetic link between those taking the DNA test. Further to that, the results are processed through the appropriate systems and a conclusion is reached, having covered 16 of the locus which are used as the template by which samples are matched.

Receiving the DNA Test Results

Once the DNA test is completed, the result will be sent to the participants via email, letter, fax or as otherwise agreed. The DNA test report should show the individual profile of each person that submitted a sample for the paternity test. Also the result should show the percentage probability of the stated relationship, for example in a DNA paternity test this is normally in excess of 99.99%.

There's no doubt about it - DNA testing is here to stay. Whilst most people are not very knowledgeable on how DNA paternity testing works, it is probably a good idea to gain some level of understanding given the way in which DNA testing is likely to continue to affect our lives over the coming decades. With growing calls for more extensive DNA databases and records for crime prevention, DNA testing and analysis looks set to remain at the forefront of the civil liberties/state interests debate.

Nucleotide Sequence of DNA

2012-01-03T05:54:00.001-08:00

Introduction:

Determination of the nucleotide sequence of DNA's is difficult since even the smallest DNA molecules contain at least 5,000 nucleotide units and thus are very much longer than t RNA and 5S RNA. The deoxy-nucleases are very less specific for certain inter nucleotide linkages than the ribo- nucleases. However there have been some significant attempts to research on the same.

DNA Sequencing can be defined as a representation of the nucleotides of DNA that constitute the DNA strand. It is a prime process which involves various methods to unravel the biological and genetic aspects. Sequencing is used to find the order of the different bases of nucleotides-A, T,G , C.DNA sequencing has vastly influenced and accelerated research activities.

Allan and Walter were responsible for developing a method for DNA sequencing which was based on chemical modification of DNA and cleavage at specific sites.

A newly discovered class of deoxy-ribo nucleases called restriction-endo nucleases have been found to be very useful for specific fragmentation of DNA. These species-specific bacterial enzymes can cleave at certain specific points of DNA molecules other than those naturally present in the cells from which are derived. Restriction endo nucleases function biologically to protect a given organism from the deleterious effects of a foreign DNA introduced into the cell. Another approach to the sequencing of DNA specimens is made possible by chemical modification of DNA-to yield apurinic or apyrimidinic acids.

The restriction enzymes are endo nucleases which recognize and cleave the foreign DNA at the same specific sequence of bases as in the host-cell DNA which has been modified by methylation : the methyl groups of the host-cell DNA prevent the attack of the restriction endonucleases. The restriction endonucleases produce a double-strand break which cannot be repaired , as a result, the foreign DNA is degraded further by other nucleases in the cell.

By means of hybridisation tests it is possible to determine whether two given specimens of DNA have blocks or segments of complementary base sequences and what their extent may be .This results in a greater tendency for a given pair of DNA strands to associate and to form duplexes.

The importance of DNA testing

2012-01-03T05:52:00.001-08:00

As everyone knows that all of us have a unique DNA pattern that we inherit from our biological parents and it is same as theirs in genetic code. People can actually check whether they are biological children of their parents by going for Parental DNA testing. It is done mostly by fathers who are having doubt whether they are the biological father of the child he is raising up. A DNA paternity test has almost 99.99% accuracy rate and no matter what its result can never be wrong irrespective of the parents accept it or not. Currently, Parental DNA testing is the correct way to determine paternity of a child.

In today's world where mutual trust has become a rare word, more and more people are going for a Paternity DNA test. It is the most scientific and accurate way to settle down any concern about the parentage of the child. Most of the times it used to settle down property related disputes. Popularly, it is used to check on whether the child or children are the heir to the father in case of some doubts about the child's heirship. Or in cases where the father doubts that his wife is cheating on him, in such situations Paternity DNA testing is mostly resorted to.

Most DNA paternity testing is done in utmost secrecy and confidentially. Usually within five days of test the results are out. In most of the countries and states, Parental DNA testing is legal but it is advisable to check out local laws before going for the test. In earlier days, the only way to check the paternity was to examine the physical similarities between the parents and the child. But after the medical developments, it has become very simple to decide on the paternity of the child. It is almost a painless way of medical test.

The DNA from the parents is very vital while taking up a Paternity DNA test, especially that of the father. All countries have different rules and laws related to DNA testing but in almost all countries it is legal. A DNA Paternity test is accepted worldwide nowadays because of its accuracy and authenticity. It is mostly useful in resolving legal issues. But before going for a Paternity DNA test, one should make certain that the DNA testing centers stock up all samples and case files in a protected area with tightly controlled admittance. It is very useful to clear any doubts regarding the paternity of the child.

DNA is not only used in paternity checking but it is very useful to solve criminal cases also. As you already know that people around the world carry a unique DNA and has a unique entity to it. The usage of DNA testing in solving criminal cases is called DNA forensic testing. In this method, the DNA of the accused and the DNA found in the scene if any is compared. If they match it means that he or she is the convict. Forensic DNA tests are becoming very useful nowadays for solving crimes and many police forces across the globe are using it.

How To Get A DNA Test

2012-01-03T05:49:00.001-08:00

There are many reasons why you might want to get a DNA test. Although we often see DNA testing used in TV forensics shows, one of the top reasons for getting a DNA test is to determine paternity. DNA paternity testing conclusively determines if a man is the father of a particular child. DNA maternity tests and sibling tests are also available. For those who are interested in genealogy or ethnic origins, many DNA labs now offer DNA ancestry testing.

If you're wondering how to get a DNA test, you can find quite a few DNA labs online. There are certainly walk-in DNA labs scattered around the country, but using an online DNA testing provider is one of the most convenient ways to get a DNA test. For DNA paternity testing, online labs will normally send you a free DNA sample collection kit. Once you've collected your DNA samples, you return them along with payment to the DNA lab.

Most testing for relationships, like paternity, maternity and siblingship, is also divided into DNA testing for peace of mind and DNA testing for legal proceedings. You can get a DNA test for peace of mind quite easily. The cost is usually lower and you can collect your own DNA samples yourself at home. But if the DNA test results are to be used in legal situations, then it's important to purchase legally admissible DNA testing from the lab. For DNA test results to be accepted by a court, DNA samples must be collected by a neutral third party. The third party is there to confirm the identity of the DNA donors and to ensure that chain of custody rules are observed.

Once the DNA samples are collected, they are returned to the lab for analysis. DNA test results can normally be received in as few as five working days. For an extra fee, some DNA labs offer a three day turnaround of test results. Test results are usually mailed to the recipient. Some online DNA labs offer online results.

How your results will look depend on the DNA test ordered. For example, in a DNA paternity test, the alleged father is either excluded or not excluded. Paternity and maternity test provide conclusive results. DNA siblingship tests are more complex and the results will be in the form of a percentage chance of relationship. DNA ancestry testing results vary by provider. In all cases, you should do some online research ahead time so you'll know that the test you've ordered provides the kind of results you need.

DNA Polymerase

2012-01-03T05:48:00.000-08:00

DNA Polymerase is an enzyme that allows new cells in the body to be created and strands of DNA to be duplicated. These enzymes store information from a cell as the divides, allowing the new cell to contain the same information. When the enzymes duplicate information from the original cell before cell division, it is called polymerization. Additionally, DNA Polymerase are useful when duplicating DNA. These enzymes can use strands of DNA as a guide, or template, and assist in creating a duplicate strand. The enzymes are also useful in cell repair. With the ability to assist in cell reproduction, these enzymes can also help prevent the death of cells.

When replicating DNA, DNA Polymerases add nucleotides to a part of the DNA strand that match the guide, or template, strand. The original DNA strand creates a replication fork, which allows the DNA Polymerase to do the job of synthesizing new DNA. Essentially using a piece of one strand of DNA to make another, much like a copy machine would for a document, in a way. In order for this DNA replication to occur, there has to be a strand of DNA that creates a replication fork. Without the replication fork, nothing can happen, because the DNA strand cannot be created from scratch.

Some DNA Polymerases can correct DNA errors. When building a new strand, there are some of these enzymes with an ability known as proofreading. Proofreading allows the DNA Polymerase to recognize and error, remove it, and replace it. The result is an error-free strand of DNA. Not all of the enzymes possess this ability. Since it is only possible for these enzymes to use existing strands of DNA as a guide or template, error correction only works with mistakes. In other words, it is not possible to make something different in the replication than it is in the original.

There are seven family subclasses of DNA Polymerase. Some of these subclasses have been thoroughly studied, such as Family Subclass I. In this subclass there are a number of bacteria polymerase, and it includes both replicative and repair DNA Polymerases. Other subclasses have not been studied a great deal, so more exploration is required to garner knowledge. An example is Family Subclass IV, of which little is known. There is even a subclass—Family Subclass VII—that uses RNA as a guide, or template, for replicating strands of DNA.

DNA Polymerases, in effect, make reproduction possible. Because of their ability replicate strands of DNA and even correct errors, biological traits are passed from parents to children. It is DNA Polymerase that makes a child of two brown-eyes parents have brown eyes. Many children resemble their parents in one way or another, and that is because of their DNA, of which part is a replication of a parent's DNA. Reproduction, as we know it, would be very different if it were not for these little enzymes. The enzymes take DNA information from two parents, and replicate it for their offspring.

Understanding DNA Technology

2012-01-03T05:47:00.000-08:00

Without a doubt, DNA technology has revolutionized the world of science. Scientific fields of biochemistry, genetics, biology and even forensics have been changed by the use of this powerful technology. Deoxyribonucleic acid, otherwise known as DNA, is an organism's genetic material. This technology has solved many mysteries behind evolution, diseases and even human behavior.

DNA technology is also being widely used to verify biological relationships and the identity of individuals living or deceased. Major advances in DNA profiling have enabled DNA tests to be completed in just a short time.

There are many technologies used in DNA testing. The most common of which are Electrophoresis, Short Tandem Repeats (STRs), Polymerase Chain Reaction (PCR), Mitochondrial DNA Sequencing (mtDNA Sequencing) and Restrictive Fragment Length Polymorphism or RFLP. A brief description of each technology is provided below.

Electrophoresis is a technique in separating DNA fragments according to size by introducing an electric field into the DNA molecule. The DNA molecule is set on a viscous medium, referred to as the gel. Longer and smaller molecules are separated because of their different abilities to pass through the gel.

Short Tandem Repeats (STRs) is a type of DNA analysis performed to examine specific areas in a DNA. Each individual has differences in certain DNA regions. These differences are used to ascertain the identity of an individual.

Polymerase Chain Reaction (PCR) is a technique used to create precise DNA replications. Millions of replications are created thereby allowing DNA analysis to be performed on samples that are extremely tiny such as a couple of skin cells. The sample though must not be contaminated by DNA of another source.

Mitochondrial DNA Sequencing (mtDNA Sequencing). There are two types of cells in a DNA – nuclear DNA and mitochondrial DNA. There are cases wherein a sample is too old and no longer has nuclear DNA. mtDNA Sequencing is a technique used to recover mitochondrial DNA. Forensics uses this type of technology on cases that have been unsolved even after so many years.

Restrictive Fragment Length Polymorphism (RFLP) DNA technology is one of the first technologies used in DNA analysis and is no longer widely used. RFLP analyzes different lengths of DNA fragments from the digestion of a sample with a restriction endonuclease enzyme.

DNA - The Soul of Life

2012-01-03T05:44:00.000-08:00

We live that all organisms create offsprings of their own soft whether it is a lone celled carnal same Rhizopod or a multicellular cranelike suchlike a equine. Rhizopod produces a daughter rhizopod, and a buck produces a fille framing. All this is researchable honourable because a very unscheduled material that is termed as deoxyribonucleic lsd or DNA. The DNA contains the patrimonial matter which makes every idiosyncratic uncomparable and this real is transferred from the parents to the offsprings. The DNA is acquaint in a specific organelle of the room titled the karyon. As the size of the room is real minute and each organism has some molecules of DNA so the DNA staleness be tightly packed surface the set and this contour of chromosome. During cadre discord, the DNA unwinds so that it can be derived and transferred to the daughter cells. DNA also carries manual for catalyst reasoning so that opposite natural processes can be regulated usually. The DNA time wrong the organelle is termed as thermonuclear DNA and the total set of nuclear DNA is designated as genome. Unconnected from its event region the set, DNA is also tense in the radiophone organ named as mitochondria which are the force houses of the cells. During intersexual breeding the offsprings get half of the atomic DNA from the theologian and half from the care but the mitochondrial DNA is inherited completely from the mother as the spermatozoan cells do not include mitochondria after creation.

The DNA particle was archetypical observed in the dead 1800s by a Germanic biochemist Frederich Miescher. But nearly a century passed after that and the scientists couldn't follow in unraveling the secret of the DNA molecule. The perplexity of the DNA was solved in 1953 by the towering totality of James Engineer, Francis Biochemist, Maurice Explorer and Rosalind Franklin. By using X-ray diffraction framework the scientists pyramidical out the threefold spiraling artifact of DNA that encodes the transmitted aggregation of every cause extant on this connector.

The chemical structure blocks of DNA are called as nucleotides. The nucleotides are settled of ternion components: a salt radical, a edulcorate and one of the four types of nitrogenous bases. To work a finish strand of DNA nucleotides are linked in the comprise of chains with cyclical opus of salt groups and sugars. The digit types of nucleotide bases that make DNA are purine (A), guanine (G), cytosine (C) and Thymine (T). The planning of these nitrogenous bases within a DNA mote is rattling special. The purine can always set with thymine on one face of the DNA curve and cytosine can also twosome with purine on one sidelong of the DNA spiral. This particularised process titled as Chargaff's ruler which plays a rattling central enactment in the reproduction of the DNA particle.

The cognition of DNA reproduction proceeds after the breaking of the fragile chemical bonds between the two poly nucleotide chains by an enzyme. The DNA desert breaks in the area separating the wrong pairs. These new separated strands now make as templates from which the new strands of DNA will be obtained. Surface the karyon umteen redundant nucleotides are present. The bases premier certificate with the bases immediate on the model which present check meet according to the Chargaff's restrain. When the cast new poly nucleotide concern. This activity is repeated with both the example strands of DNA. The livelong affect is repeated thousands of instance in ordination to comprise the two molecules of DNA which are just the replicates of the pilot DNA mote and all this happens during mitosis so the girl cells obtain the correct siamese dimension of the DNA. When an mistake occurs during the operation of DNA reproduction modification occurs. The alteration causes either excision or gain of ground pairs and the proteins also get defected by having reprehensible pairs of alkane acids.

One of the significant functions of DNA is protein synthesis. The knowledge of accelerator reasoning is realized in two steps. The introductory support is transcription and the product stair is movement. In transcription the radiophone uses the collection from a factor in position to state a catalyst. Both the DNA and RNA molecules are related in artefact except the fact that RNA is shorter than DNA and bears the edulcorate ribose instead of deoxyribose that is time in DNA. RNA also differs from DNA in having a supposal uracil in situation of thymine. During transcription, the write of RNA that is created is titled rna or traveller RNA because it is victimised as a "traveller" to transfer aggregation from
advertiser. The booker positions the RNA polymerase on the paw street of DNA and guides it to the justness direction. As the RNA polymerase moves, it creates a new biochemist from the actor nucleotides. The RNA polymerase continues until it reaches a quit signalise at the end of the factor. The RNA polymerase then detaches itself from the DNA and the RNA series is released, creating rna.

When the rna sends the content from the DNA to the ribosomes it is converted into the communication of group acids. When paraffin acids are blown a catalyst is created. The mRNA transfers the info from the DNA to the ribosomes in the language of nucleotides. The ribosomes take on a fact abode on the rna which is titled begin codon which is prefabricated up of ternary nucleotide bases indicating that it is waiting to translate a message. The radical acids that gift subsequent grade catalyst get across the somebody RNA or tRNA time they are affianced to the ribosomes. The rna moves the alkane acids along the mRNAs so that the content can eat across the ribosome.

DNA AND MOLECULAR GENETICS

2012-01-03T05:06:00.000-08:00

The physical carrier of inheritance

While the period from the early 1900s to World War II has been considered the "golden age" of genetics, scientists still had not determined that DNA, and not protein, was the hereditary material. However, during this time a great many genetic discoveries were made and the link between genetics and evolution was made.

Friedrich Meischer in 1869 isolated DNA from fish sperm and the pus of open wounds. Since it came from nuclei, Meischer named this new chemical, nuclein.

Subsequently the name was changed to nucleic acid and lastly to deoxyribonucleic acid (DNA). Robert Feulgen, in 1914, discovered that fuchsin dye stained DNA. DNA was then found in the nucleus of all eukaryotic cells.

During the 1920s, biochemist P.A. Levene analyzed the components of the DNA molecule. He found it contained four nitrogenous bases: cytosine, thymine, adenine, and guanine; deoxyribose sugar; and a phosphate group. He concluded that the basic unit (nucleotide) was composed of a base attached to a sugar and that the phosphate also attached to the sugar. He (unfortunately) also erroneously concluded that the proportions of bases were equal and that there was a tetranucleotide that was the repeating structure of the molecule. The nucleotide, however, remains as the fundemantal unit (monomer) of the nucleic acid polymer. There are four nucleotides: those with cytosine (C), those with guanine (G), those with adenine (A), and those with thymine (T).

Molecular structure of three nirogenous bases. In this diagram there are three phosphates instead of the single phosphate found in the normal nucleotide. Images from Purves et al., Life: The Science of Biology, 4th Edition, by Sinauer Associates and WH Freeman (, used with permission.

During the early 1900s, the study of genetics began in earnest: the link between Mendel's work and that of cell biologists resulted in the chromosomal theory of inheritance; Garrod proposed the link between genes and "inborn errors of metabolism"; and the question was formed: what is a gene? The answer came from the study of a deadly infectious disease: pneumonia. During the 1920s Frederick Griffith studied the difference between a disease-causing strain of the pneumonia causing bacteria (Streptococcus peumoniae) and a strain that did not cause pneumonia. The pneumonia-causing strain (the S strain) was surrounded by a capsule. The other strain (the R strain) did not have a capsule and also did not cause pneumonia. Frederick Griffith (1928) was able to induce a nonpathogenic strain of the bacterium Streptococcus pneumoniae to become pathogenic. Griffith referred to a transforming factor that caused the non-pathogenic bacteria to become pathogenic. Griffith injected the different strains of bacteria into mice. The S strain killed the mice; the R strain did not . He further noted that if heat killed S strain was injected into a mouse, it did not cause pneumonia. When he combined heat-killed S with Live R and injected the mixture into a mouse (remember neither alone will kill the mouse) that the mouse developed pneumonia and died. Bacteria recovered from the mouse had a capsule and killed other mice when injected into them!

Hypotheses:

1. The dead S strain had been reanimated/resurrected.

2. The Live R had been transformed into Live S by some "transforming factor".

Further experiments led Griffith to conclude that number 2 was correct.

In 1944, Oswald Avery, Colin MacLeod, and Maclyn McCarty revisited Griffith's experiment and concluded the transforming factor was DNA. Their evidence was strong but not totally conclusive. The then-current favorite for the hereditary material was protein; DNA was not considered by many scientists to be a strong candidate.

The breakthrough in the quest to determine the hereditary material came from the work of Max Delbruck and Salvador Luria in the 1940s. Bacterio phage are a type of virus that attacks bacteria, the viruses that Delbruck and Luria worked with were those attacking Escherichia coli, a bacterium found in human intestines. Bacteriophages consist of protein coats covering DNA. Bacteriophages infect a cell by injecting DNA into the host cell. This viral DNA then "disappears" while taking over the bacterial machinery and beginning to make new virus instead of new bacteria. After 25 minutes the host cell bursts, releasing hundreds of new bacteriophage. Phages have DNA and protein, making them ideal to resolve the nature of the hereditary material.

In 1952, Alfred D. Hershey and Martha Chase (click the link to view details of their experiment) conducted a series of experiments to determine whether protein or DNA was the hereditary material. By labeling the DNA and protein with different (and mu tually exclusive) radioisotopes, they would be able to determine which chemical (DNA or p rotein) was getting into the bacteria. Such material must be the hereditary material (Griffith's tr ansforming agent). Since DNA contains Phosphorous (P) but no Sulfur (S), they tagged the DNA with radioactive Phosphorous-32. Conversely, protein lacks P but does have S, thus it could be tagged with radioactive Sulfur-35. Hershey and Chase found that the radioactive S remained outside the cell while the radioactive P was found inside the cell, indicating that DNA was the physical carrier of heredity.

How Stem Cells Are Changing the Way We Think About Disease

2011-12-03T19:10:00.000-08:00

Treating disease is about fixing broken parts — about replacing cells that no longer work as they should, repairing tissues that falter and boosting systems that fail. But curing disease is a different matter. To cure disease, you have to do all of that and more. You have to remove the pathological cause of the problem and to ensure that it doesn’t return. This requires teasing out where rogue cells went wrong and finding a way to nurture healthier ones to replace them.

That’s where the promise of stem cells lies. As the mother cells of every tissue in the body, they are the biological ore from which the body emerges. All cells can trace their provenance to a stem cell, to the embryo and the first days after fertilization when such cells form. It’s now possible to grow stem cells in a lab, not just from embryonic tissue but also by turning back the clock on an already developed cell like one from the skin, bypassing the embryo altogether with four important fountain-of-youth genes that rework the skin cell’s DNA machinery and make it stemlike again.

These biological wonders are transforming the way we treat disease as well as how we think about unhealthy states and even the way we approach aging. Now that it’s possible to generate an unlimited supply of stem cells from our own tissues, scientists say it’s only a matter of time before they figure out how to turn those cells into nerves, heart cells, liver cells or any other living tissue we may need if we get sick or injured. Disease, therefore, no longer needs to be a black box of medical mystery. To expose what makes nerve cells in patients with Lou Gehrig’s disease lose their ability to control muscle, for example, some researchers have already grown motor neurons from stem cells made from patients’ skin and watched how they develop, at first normally, then veering off into pathology. Such a disease-in-a-dish strategy led to the discovery that it’s not the motor neurons that are at fault but that other cells assigned the task of supporting these nerves turn toxic and break down the connections to muscle. With that insight, drugmakers have begun screening compounds to see if they can find an agent to block that lethal effect.

Even when we already know what causes a disease, stem cells can help us improve on existing therapies. Stem cells may make it possible for Type 1 diabetics, for example, to eliminate their repeated blood checks and insulin injections by someday allowing them to generate their own insulin-making pancreatic cells. If stem cells can replenish the dying brain neurons that affect memory and cognition, Alzheimer’s patients might also benefit.

But why stop there? If these cells can replace ailing cells, why not aging ones? Can stem cells, as a source of replenished, renewable and healthy cells, keep us young forever? “In the absence of disease, why would we die?” asks Douglas Melton, a stem-cell researcher at Harvard University. “With stem cells, can we get control of the aging process?”

There’s tantalizing evidence that this might be possible, at least when it comes to blood and the immune system. Thomas Rando, a researcher at Stanford University, thinks stem-cell treatments may enhance healing in older patients who have difficulty recovering from surgery or a fracture. But he’s also thinking about deeper issues involving the power of regenerative medicine. “There are very basic questions I hope we can make headway on using stem cells — in terms of understanding cellular aging, how that’s related to tissue aging and the aging of an organism,” he says. Which leads to the interesting possibility that with stem cells, we may no longer define age as how old we think we are but as how old our cells tell us we are.

Stem Cell Research And Therapeutic Cloning

2011-12-03T19:02:00.000-08:00

Stem Cell Research And Therapeutic Cloning - Presentation Transcript

Stem Cell Research and Therapeutic Cloning Kirsten Mueller Government 12H Period 7

What are Stem Cells?

Cells from the umbilical chord or placenta of a fetus that can become any cell

Stem cells morph into what ever doctors need them to be like liver, muscle, skin or heart cells.

Why are Stem Cells Important?

Stem cells are used to replaced damaged cells that no longer function or do not function properly.

Scientists believe that stem cells will be able to “grow replacement livers or hearts (or any of a variety of organs) for transplant without fear of rejection. They might be used to create healthy nerve cells for people with Alzheimer's or Parkinson's disease. Skin cells could be derived from cloned stem cells for burn victims,” (“AFAR: Therapeutic Cloning”).

What is Therapeutic Cloning?

Therapeutic cloning uses stem cells to correct diseases and other health problems that someone may encounter.

Therapeutic cloning does not clone to make full humans but rather is used for the stem cells of the embryo, (“Therapeutic Cloning“).

Controversy over Therapeutic Cloning

The Senate is dealing with this controversy over whether of not to ban cloning all together. The decision the Senate has to make can affect medical research and everything else in between.

There are two sides to this debate; one being those in favor of cloning therefore allowing therapeutic cloning and the other, banning cloning all together.

Those in favor of continuing cloning believe that cloning should continue for research to help people to cure their diseases or to help them with their injuries.

The other side of the story wishes to ban everything all together.

Pros

Those in favor of allowing cloning view that the final outcome of the research is much more beneficial seeing as many lives will be saved in the process, (Pro: Cloning Supporters). Therapeutic cloning is a very practical science when it comes to someone suffering from a terminal illness or something of the sorts.

For a diabetic, a new liver could be created to produce insulin or for someone with cardiac complications new heart tissue can be created.

Pros continued

When a baby is born, stem cells are present on the umbilical chord which can be harvested and saved for future use. These stem cells are then stored in a chord cell bank where the patient can access them at any time if needed. Those who choose to store their stem cells maybe luckier than others because if something were to happen, such as they contract a terminal illness, the stem cells can be used to replace the damaged cells and become fresh, new healthy cells and the patient would become healthy again.

Cons

Most people who are strongly against cloning in all forms have a problem with the ethics or the religious aspect of the science however there are some who believe that the consequences of cloning are stacked against the benefits of cloning.

Some people strongly believe that they are cheating the natural or “playing God”, (Con: Anti-Cloning Research).

Many doctors believe that since the tissue is an exact match to the patient there will be no tissue rejection or infection. However anti-cloning believers feel that the process will not go as smoothly as stated. They believe that there can be tissue rejection and that this will lead to more deadly diseases and illnesses.

The Federal Government under Bush

Therapeutic cloning was strictly prohibited under Bush.

The Bush administration supported and passed the Dicky Amendment which “prohibits the Department of Health and Human Services (HHS) from using appropriated funds for the creation of human embryos for research purposes or for research in which human embryos are destroyed,” (Dickey Amendment).

This law strictly federal funding however private funding is still allowed. This means that tax payers are not paying for something that would put a human embryo at risk or destruction. This amendment is voted on every year and every year it’s voting is upheld therefore it remained (The Administration’s Human Embryonic Stem Cell Research Funding Policy: Moral and Political Foundations).

The Federal Government Under Bush continued

In 2007, Congress proposed a bill that overturned the Public Health Service Act and allow for the funding for stem cell research for therapeutic cloning. The bill was introduced on January 4, 2007, reported by the committee on January 8, 2007, passed in the Senate on April 11, 2007, and passed in the House on June 7, 2007. However, since the Bush Administration was still in place, the President rejected it on June 20, 2007, (S. 5: Stem Cell Research Enhancement Act of 2007). Obama, Biden and McCain all voted in favor of the proposed bill, (U.S. Senate Roll Call Votes 110th Congress - 1st Session).

The Federal Government Under Obama

Barack Obama has introduced legislation in Illinois allowing for stem cell research and would not support Bush’s bill that prohibited the funding of such research, (Democratic Presidential Candidate - Barack Obama).

On March 9, 2009, Barack Obama delivered a speech reversing the Bush Administration’s ideas on stem cell research and therapeutic cloning.

Barack Obama is allowing for stem cell research to be funded by the federal government because he believes it to be an important advancement in the scientific world and a brighter future to those with diseases that could be cured with stem cells through therapeutic cloning. Obama believes that stem cell research is scientifically worthy and worth spending money on if it is going to help patients in the future.

State Governments

Many states have created their own laws to deal with this new change in events so to speak.

According to the State Human Cloning Laws, states such as Arkansas, Indiana, Michigan, North Dakota, and South Dakota prohibit therapeutic cloning whereas California, Connecticut, Maryland, Massachusetts, Missouri, New Jersey and Rhode Island allow the research of therapeutic cloning.

Iowa’s Government

In Iowa, talk of passing a bill to allow stem cell research and therapeutic cloning has been brought up. Representative Mary Mascher introduced the change to the Senate File 162 - Iowa Stem Cell Research and Cures Initiative which passed by a slim number of votes in the House and Senate, (Iowa Legislature Passes Therapeutic Cloning Bill). This revokes the bill originally in place to ban all sorts of cloning.

Kentucky’s Government

The state government of Kentucky recently passed a bill to ban all types of cloning. Only recently was it shown that therapeutic cloning was banned by this bill, (Kentucky House Members Passed Cloning Bill Without Realizing Law Would Ban Therapeutic Cloning). Many of the Representatives who voted in favor of this bill were unaware of the fact that it banned therapeutic cloning. Top researchers that the Universities of Kentucky and Louisville are upset that research has been halted due to this bill.

The General Publics View

Of the twenty -nine people that completed this survey a majority (twenty - seven people) agree that therapeutic cloning should be an accepted practice in the United States if America. Only two people believe that therapeutic cloning is wrong therefore it should be a banned practice.

Seeing that the majority are in favor of therapeutic cloning, Bush’s laws concerning therapeutic cloning must not have been popular. Today, Barack Obama has overturned the Bush Administration laws about stem cells research (specifically therapeutic cloning) which is what seems to satisfy the public opinion.

The General Publics View continued

With concerns to harvesting stem cells, there are two ways to go about it, harvesting the stem cells from the umbilical chord when the baby is born or harvesting the stem cells from the placenta of a cloned fetus which in turn aborts the fetus.

According to the survey, most people are in favor of allowing the stem cells from the umbilical chord. This process does not hurt the newly born child but it allows for only a limited number of stem cells. If taken from the placenta of a cloned embryo, an unlimited supply can be taken however, the fetus will die.

In terms of harvesting stem cells from the placenta of a cloned embryo, it is split thirty-four and a half percent between somewhat agree and somewhat disagree.

When asked about whether or not stem cell research and therapeutic compromise peoples beliefs, eighteen people (a majority), believe that it does not. This shows that therapeutic cloning and stem cell research will be a field in medicine that will continue to grow rapidly.

The General Publics View continued

Stem cell research is a very costly procedure that can leave people high and dry of cash.

When asked about the financial aspect of stem cell research and therapeutic cloning, a majority of people (twenty-two people) agree that this should all be taken care of by insurance companies. The cost of having this procedure done should not be paid out of the patients pocket but by insurance companies.

Also, most people believe that tax payers should pay for stem cell research but seeing as somewhat disagree was one vote short from a tie, it can be seen that this is also a very disputable issue concerning financing.

The Future

Stem cells are the future of the scientific world. Therapeutic cloning is just one of the many advancements that scientists have made. However with this advancement and the continued advancement of cloning in other aspects still circles around to the debates about whether or not cloning, more specifically therapeutic cloning, should be an acceptable practice in the medical field.

What Are the Different Types of Stem Cell Companies?

2011-12-03T18:58:00.001-08:00

A stem cell is a cell which has the ability to continuously divide and develop into various tissues and other cells. Unlike mature cells, stem cells do not develop into one specific type of tissue, but retain the ability to divide and create various tissues, making them a primary source of tissue renewal and repair. A number of companies worldwide have become involved in different aspects of stem cell technology. Some stem cell companies specialize in stem cell retrieval and storage, others develop stem cell chains to sell for research or development, and biopharmaceutical companies use stem cells to try to develop medications and treatment for specific diseases. Some companies have begun treating patients with various degenerative diseases with stem cell transplants.

Some stem cell companies specialize in the development of embryonic stem cells. These are generally obtained by fertilizing a human egg, usually in vitro, and letting the embryo develop for four or five days. The stem cells are then removed from the embryo and grown in a culture dish. Significant controversy surrounds embryonic stem cell research because it involves the creation, growth and then destruction of a human embryo. Some researches see great potential in the ability of embryonic cells to develop into all cell types, yet there is also concern about their unstable nature of growth and the potential for harm that kind of growth can cause.

Other stem cell companies have opted to only work with adult stem cells and avoid the ethical controversy. One of the most potentially versatile adult stem cell comes from bone marrow. While it is reasonable to expect bone marrow stem cells to create a variety of blood cells, in experiments with animals, these cells have successfully developed muscle cells, and appear to be affective in treating muscular dystrophy in mice. Another reason many stem cell companies prefer adult stem cells is that they are less likely to result in uncontrolled growth and tumor development than embryonic stem cells.

The treatment of degenerative disease is the primary purpose for stem cell research. Stem cell companies are currently using adult stem cells to develop treatments for a variety of diseases. Bone marrow transplants, which are essentially stem cell treatments, have been used for years as a treatment for leukemia. Bone marrow cells are currently being used in test trials with patients suffering from bone defects. Osteoarthritis, cartilage regeneration and degenerative disc disease are also targets for bone marrow stem cell research.

Other stem cell companies focus on obtaining adult stem cells from a variety of sources, including umbilical cord, placenta blood, baby teeth, and various adult tissues. Numerous companies have opened throughout North America, Europe, Australia and Asia which specialize in stem cell collection and research. Many countries, like the US, have extremely stringent requirements for safety and effectiveness before a drug or treatment can be authorized. Other countries have allowed stem cell companies to begin using stem cell injections to treat members of the general public for a variety of conditions.

What Is Stem Cell Research?

2011-12-03T18:56:00.000-08:00

Stem cell research is a relatively new technology that takes primitive human cells and develops them into most any of the 220 varieties of cells in the human body, including blood cells and brain cells. Some scientists and researchers have great hope for this research and its ability to uncover treatments and possibly even cures for some of the worst diseases including heart disease, diabetes, and neurodegenerative diseases like Alzheimer's and Parkinson's. Along with these hopeful possibilities, stem cell research also gives rise to fear of human cloning and serious concerns over the ethics of conducting scientific research on, which includes the destruction of, human embryos.

Types of Stem Cells

Human stem cells primarily come from embryos or adult tissue. Embryonic stem cells can be created solely for the purpose of stem cell research or they can be the leftover from other processes, such as from in-vitro fertilization (IVF). Fertility treatments usually result in the creation of multiple embryos, and since only the most viable are selected for implantation, some embryos are not used. These extra embryos can be discarded, donated to others seeking fertility assistance, preserved, or donated to research; most commonly, leftover embryos are discarded.

Adult stem cells can be harvested from adult tissue with minor, if any, harm to the adult. Embryonic stem cells, however, are said to be generally easier to extract than the adult stem cells, and embryonic stem cells are said to have more uses than their adult counterparts. Much of the stem cell research debate centers on embryonic stem cells because of their potential uses, and because of questions about when life begins.

Ethical Issues

The overall debate over the ethics of stem cell research involve two major ethical concerns: (1) the potential for human cloning, and (2) whether these embryos, or pre-embryos as some refer to them, are human life. Perhaps the initial controversy is related to the possibility of human cloning. Especially when it first gained popularity, researchers were concerned with the potential for using stem cells to clone humans. Proponents make many arguments in support of human cloning including the possibility of creating another “you” should body parts or tissues be needed later in life as one may develop illnesses and diseases. Opponents primarily argue that it is not within man’s judgement to manufacture, manipulate, or destroy human life.

The other major ethical issue related to stem cell research involves the ongoing debate over when life begins. Some say that life begins at conception and that the use of humans, even immature ones, for research purposes is unethical. Others claim that the embryos are only tiny amounts of undifferentiated tissue and since they are already scheduled for destruction, and have great potential benefit, they should be used to potentially help others.

Legal Differences

It is legal to conduct stem cell research in the United States, even for the purposes of human cloning. In 2001, President Bush authorized the issuing of federal funds for the research of over 60 existing stem cells lines. The funding was restricted to these cell lines because the issue of life and death was already decided; that is, the stem cell lines at that point were capable of independent and infinite regeneration. In 2009, President Obama reversed the policy and allowed federal funding to be used towards additional stem cell lines.

Other countries permit stem cell research to varying degrees. Countries such as Japan, Sweden, and the United Kingdom have made it legal, even for purposes of human cloning. Countries including Australia, Canada, and France allow adult and leftover embryonic research but not human cloning. Austria, Ireland, and Poland have some of the most restrictive laws on this type of research.

Stem Cell Nutrition for Pets and Horses

2011-12-03T18:38:00.002-08:00

Plant-based stem cell enhancers have been shown to support the release of millions of stem cells from the bone marrow very quickly. These stem cells can then migrate and attach to any cells, tissue, bone, muscle, cartilage, organ anywhere in the body needing repair. Once they attach, they become that tissue and multiply 3 to 5000 times. When there is an injury or a stress to an organ of your beloved pet or horse, compounds are released that reach the bone marrow and trigger the release of stem cells. Stem Cells can be thought of as “master” cells. Stem cells circulate and function to replace dysfunctional cells, thus fulfilling the natural process of maintaining optimal health.

As they do in humans, adult stem cells reside in animals bone marrow, where they are released whenever there is a problem somewhere in the body. Looking back on stem cell research, we realize that most studies have been done with animals, mostly mice, but also with dogs, horses, pigs, sheep and cattle. These studies have revealed that animal stem cells conduct themselves the same way human stem cells do. When there is an injury or a stress to an organ of your beloved pet or horse, compounds are released that reach the bone marrow and trigger the release of stem cells. The stem cells then travel to tissues and organs in need of help to regain optimal health.

EQUINE STEM CELL NUTRITION

Eve-Marie Lucerne - Eve-Marie keeps nine horses, “all older thoroughbreds,” and was eager to participate in the trials of a new stem cell enhancer for horses. She shared her allotment of test products with a few large commercial thoroughbred farms, veterinarians and other “horse people” she knows, and has been pleased with the consistently excellent results she has seen and others have reported to her. “This product will help so many animals,” she says, adding, “People and animals are more alike than we are different. So it makes sense that a stem cell enhancer for animals with promote their health, too.”

Eve-Marie’s pet product trials show dramatic results. “For several horses facing serious physical challenges, cases where the animals might have to be put down, we saw a return to quality of life. This did not happen before Equine Stem Cell Nutrition.” Eve-Marie says that this turnaround was quick, less than two weeks in many cases, and that the subject horses were back to health and enjoying pasture life within a month. One of the unofficial trial subjects for the equine stem cell nutrition was a 30-year old donkey who was in “bad shape,” Eve-Marie reports. He had

chronic respiratory difficulty and could move about only haltingly”. His owner had stem cell enhancer supplements to help with her own serious health challenges and shared it with the donkey. “The donkey’s owner says this is the first time she wasn’t sick, and her donkey is walking all around, feeling great an enjoying life again!”

Farrier and National Hoof practitioner Stephen Dick received some of the trial product from Eve-Marie, and had good results with the two horses he selected for trial. For a 12-year-old quarterhorse stallion, the equine product brought dramatic results. “This horse used to lie down twenty-two hours of the day, because he suffered discomfort whenever he stood,” Steve reports, continuing, “after a couple of weeks with Equine Stem Cell Nutrition, he was getting up and moving around, showing no discomfort.” For a high-spirited mare with a leg problem, the equine product brought about a whole new lease on life, Steve says. “This horse had been in a stall for 8 months. After about 6 weeks taking the equine product with her grain, her condition had improved and she was out of the stall, walking around in the pasture again.”

Little Joe, a small 18-year-old quarterhorse that Judy Fisher bought when he was nearly 400 pounds underweight. “You could count his ribs,” Judy says, remembering, “and his backbone stuck up like a ridge all along his back. He was very, very thin!” Little Joe also suffered from breathing problems that kept him lethargic and inactive. Vet-recommended remedies were unsuccessful in changing Little Joe’s physical problems, and the vet told Judy he didn’t expect Little Joe to live through the winter. “I figured Little Joe was in such bad shape that anything was worth a try,” she says. She began giving the horse stem cell nutrition with his feed and grain twice a day. Within a couple of weeks, Judy was surprised to see Little Joe beginning to gain weight and run, buck, snort and kick. His breathing was no longer labored and his skin and coat were improving. Within six weeks Little Joe’s overall appearance had changed dramatically. He had put on almost 300 pounds. “When his former owner came to visit,” Judy says, “he didn’t recognize Little Joe. That’s how different he looked!”

Sara participated in the stem cell nutrition product trials with her two horses and her 80-pound mixed-breed dog. She noted significant improvement in the health and quality of life for all three animals during the time of the trials. For JJ, Sara’s 18-year old quarterhorse, the equine product brought about improvements in his overall mood, appearance and alertness quickly. “He really liked the product from the beginning,” Sara reports, pointing out that Hank, her 16-year-old thoroughbred/quarterhorse, had not taken to the taste of it too readily. “I was able to slowly wean him on it though,” she says. For Hank, the equine product was a balm for the skin problems resulting from his allergy to fly bites. “His skin condition improved dramatically.” Sara reports, noting that before the equine product the horse had scratched and bitten himself into ope wounds; after the equine product, the scratching and biting dropped off to almost nothing. Sara also noticed an increase in Hank’s energy and liveliness in the first week on the equine product. The horse’s foot and hip discomforts also responded well, leading to a noticeable increase in his mobility and an overall improvement in his quality of life throughout the two-month study. Sare gave the pet product to her dog, Roxy, who had suffered for two years with ear problems that led to scratching, often until her skin was raw. Vet-recommended remedies had been “temporary, quick-fixes,” Sara says, but the discomfort always returned “with a vengeance.” For the pet trials, Sara gave Roxy two tabs of the product a day for two months, noting “this is the only supplement she was getting.” Sara says “Roxy’s problem with her ears definitely improved, the hair as grown back on her head and ears, and the ear problem has not recurred,” adding that Roxy is “happier and engaging, more playful.”

Stem cells and aging: expanding the possibilities

2011-12-03T18:38:00.001-08:00

The possibility that a decline in the numbers or plasticity of stem cell populations contributes to aging and age-related disease is suggested by recent findings. The remarkable plasticity of stem cells suggests that endogenous or transplanted stem cells can be ‘tweaked’ in ways that will allow them to replace lost or dysfunctional cell populations in diseases ranging from neurodegenerative and hematopoietic disorders to diabetes and cardiovascular disease.

As you age, the number and quality of stem cells that circulate in your body gradually decrease, leaving your body more susceptible to injury and other age-related health challenges. Just as antioxidants are important to protect your cells from “free radical” damage, stem cell nutrition is equally important to support your stem cells in maintaining proper organ and tissue functioning in your body.

Stem Cells Restore Memory in Mice

2011-12-03T18:35:00.000-08:00

A new U.S. study involving mice suggests the brain's own stem cells may have the ability to restore memory after an injury. These neural stem cells work by protecting existing cells and promoting neuronal connections. In their experiments, a team at the University of California, Irvine, were able to bring the rodents' memory back to healthy levels up to three months after treatment. The finding could open new doors for treatment of brain injury, stroke and dementia, experts say.

"This is one of the first reports that you can take a stem cell transplantation approach and restore memory," said lead researcher Mathew Blurton-Jones, a postdoctorate fellow at the university. "There is a lot of awareness that stem cells might be useful in treating diseases that cause loss of motor function, but this study shows that they might benefit memory in stroke or traumatic brain injury, and potentially Alzheimer's disease."

In the study, published in the Oct. 31 issue of the Journal of Neuroscience, Blurton-Jones and his colleagues used genetically engineered mice that naturally develop brain lesions. The researchers destroyed cells in a brain area called the hippocampus. These cells are known to be vital to memory formation and it is in this region that neurons often die after injury, the researchers explained. To test the mice's memory, Blurton-Jones's group conducted place and object recognition tests with both healthy mice and brain-injured mice.

Healthy mice remembered their surroundings about 70 percent of the time, while brain-injured mice remembered it only 40 percent of the time. For objects, healthy mice recalled objects about 80 percent of the time, but injured mice remembered them only 65 percent of the time. The researchers then injected each mouse with about 200,000 neural stem cells. They found that mice with brain injuries that received the stem cells now remembered their surroundings about 70 percent of the time -- the same as healthy mice. However, mice that didn't receive stem cells still had memory deficits.

The researchers also found that in healthy mice injected with stem cells, the stem cells traveled throughout the brain. In contrast, stem cells given to injured mice lingered in the hippocampus. Only about 4 percent of those stem cells became neurons, indicating that the stem cells were repairing existing cells to improve memory, rather than replacing the dead brain cells, Blurton-Jones's team noted. The researchers are presently doing another study with mice stricken with Alzheimer's. "The initial results are promising," Blurton-Jones said. "This has a huge potential, but we have to be cautious about not rushing into the clinic too early."

One expert is optimistic about the findings. "Putting in these stem cells could eventually help in age-related memory decline," said Dr. Paul R. Sanberg, director of the Center of Excellence for Aging and Brain Repair at the University of South Florida College of Medicine. "There is clearly a therapeutic potential to this." Sanberg noted that for the process to work with Alzheimer's it has to work with older brains. "There is clearly therapeutic potential in humans, but there are a lot of hurdles to overcome," he said. "This is another demonstration of the potential for neural stem cells in brain disorders.".

The Stem Cell Theory of Renewal

2011-12-03T18:29:00.000-08:00

The Stem Cell Theory of Renewal proposes that stem cells are naturally released by the bone marrow and travel via the bloodstream toward tissues to promote the body’s natural process of renewal. When an organ is subjected to a process that requires renewal, such as the natural aging process, this organ releases compounds that trigger the release of stem cells from the bone marrow. The organ also releases compounds that attracts stem cells to this organ. The released stem cells then follow the concentration gradient of these compounds and leave the blood circulation to migrate to the organ where they proliferate and differentiate into cells of this organ, supporting the natural process of renewal.

Most of the cells in the human body are specialists assigned to a specific organ or type of tissue, such as the neuronal cells that wire the brain and central nervous system. Stem cells are different. When they divide, they can produce either more stem cells, or they can serve as progenitors that differentiate into specialized cells as they mature. Hence the name, because specialist cells can "stem" from them. The potential to differentiate into specialist cells whose populations in the body have become critically depleted as the result of illness or injury is what makes stem cells so potentially valuable to medical research. The idea is that if the fate of a batch of stem cells could be directed down specific pathways, they could be grown, harvested, and then transplanted into a problem area. If all went according to plan, these new cells would overcome damaged or diseased cells, leading to healing and recovery. "The life of a stem cell can be viewed as a hierarchical branching process, where the cell is faced with a series of fate switches," Schaffer says. "Our goal is to identify the cell fate switches, and then provide stem cells with the proper signals to guide them down a particular developmental trajectory."

Stem cells have the remarkable potential to develop into many different cell types in the body. Serving as a sort of repair system for the body, they can theoretically divide without limit to replenish other cells as long as the person or animal is still alive. When a stem cell divides, each new cell has the potential to either remain a stem cell or become another type of cell with a more specialized function, such as a muscle cell, a red blood cell, or a brain cell.

When a stem cell divides, each new cell has the potential to either remain a stem cell or become another type of cell with a more specialised function. Scientists believe it should be possible to harness this ability to turn stem cells into a super "repair kit" for the body. Theoretically, it should be possible to use stem cells to generate healthy tissue to replace that either damaged by trauma, or compromised by disease. Among the conditions which scientists believe may eventually be treated by stem cell therapy are Parkinson's disease, Alzheimer's disease, heart disease, stroke, arthritis, diabetes, burns and spinal cord damage. The Stem Cell Theory of Renewal: Demystifying the Most Dramatic Scientific Breakthrough of Our Time

The National Health Institute lists seventy-four treatable diseases using ASCs in therapy - an invasive and costly procedure of removing the stem cells from one’s bone marrow (or a donor’s bone marrow) and re-injecting these same cells into an area undergoing treatment. For example, this procedure is sometimes done before a cancer patient undergoes radiation. Healthy stem cells from the bone marrow are removed and stored, only to be re-inserted after radiation into the area of the body in need of repair. This is a complex and expensive procedure, not accessible to the average person. However, there is now a way that every single person, no matter what their health condition, can have access to the benefits of naturally supporting their body’s innate ability to repair every organ and tissue using stem cell nutrition.

Adult Stem Cell Physiology

2011-12-03T18:27:00.000-08:00

Supporting Bone Marrow Adult Stem Cell Release Naturally to Support Optimal Health in Humans and Animals

Scientific developments have revealed that adult stem cells derived from the bone marrow, travel throughout the body, and act to support optimal organ and tissue function. As you age, the number and quality of stem cells that circulate in your body gradually decrease, leaving your body more susceptible to injury and other age-related health challenges. Just as antioxidants are important to protect your cells from “free radical” damage, stem cell nutrition supplements from aqua-botanical extract (not from stem cells) are equally important to support stem cells in maintaining proper organ and tissue functioning in the body. Stem cell enhancers have been documented to support the release of millions of adult stem cells from the bone marrow very quickly. These stem cells can then migrate and attach to any cells, tissue, bone, muscle, cartilage, organ...anywhere in the body needing repair. Once they attach, they become that tissue and multiply 3 to 5000 times.

Supporting Bone Marrow Adult Stem Cell Release Naturally - Helping Your Body Heal Itself

Stem cell nutrition from aqua-botanical source, has shown to support the release of millions of adult stem cells from the bone marrow very quickly. These stem cells can then migrate and attach to any cells, tissue, bone, muscle, cartilage, organ anywhere in the body needing repair. Once they attach, they become that tissue and multiply 3 to 5000 times. When there is an injury or a stress to an organ, compounds are released that reach the bone marrow and trigger the release of stem cells. Stem Cells can be thought of as “master” cells. Stem cells circulate and function to replace dysfunctional cells, thus fulfilling the natural process of maintaining optimal health

When Christian Drapeau first posited that Adult Stem Cells were the very foundation of the body's natural healing system, scientific study in the field was in its infancy. His hypothesis that Adult Stem Cells, created by bone marrow, flowed to any tissue or organ needing regeneration and morphed into healthy cells of that location, was initially ridiculed by medical science. Since 2006 however, and at a geometrically increasing pace, Christian Drapeau's position gained not just momentum but widespread interest in scientific circles as study after study reveals that Adult Stem Cell science holds phenomenal promise in all areas of human healing.

stem cell enhancers has been clearly evidenced by more than 150 experiments. The health benefits of having more stem cells in the blood circulation have been demonstrated by numerous scientific studies. It would be too long here to summarize this vast body of scientific data. I simply suggest you research the work of Dr. Donald Orlic at the NIH.

Christian's theory that Adult Stem Cells are nothing less than the human body's natural self-renewal system has profound implications for every area of modern medicine. The idea that heart disease, diabetes, liver degeneration, and other conditions could be things of the past is no longer science fiction; because of recent Adult Stem Cell research breakthroughs, these are real possibilities in the short term.

Stem cells are defined as cells with the unique capacity to self-replicate throughout the entire life of an organism and to differentiate into cells of various tissues. Most cells of the body are specialized and play a well-defined role in the body. For example, brain cells respond to electrical signals from other brain cells and release neurotransmitters; cells of the retina are activated by light, and pancreatic ß-cells produce insulin. These cells, called somatic cells, will never differentiate into other types of cells or even proliferate. By contrast, stem cells are primitive cells that remain undifferentiated until they receive a signal prompting them to become various types of specialized cells.

Using Dna Testing

2011-11-02T20:07:00.001-07:00

DNA testing is by far the most effective and accurate means by which a biological relationship can be said to exist between one person and another. Whether that be through traditional paternity testing or alternatively testing some more distant relationship (usually in order to determine paternity), such as avuncular testing or grandparentage testing, there are a number of significant reasons for using DNA testing where disputes or potential discrepancies arise. Whilst there is a minimal margin for error in any testing, DNA testing is the most accurate form of establishing relationships available, which makes it ideal for use in a number of scenarios.

Legal Use
One of the most common uses for DNA testing is for legal reasons. There are a number of legal scenarios where paternity, or family relationships become important to the outcome of a case. Whether that be an intestate inheritance dispute, where determining family relationships could have a significant bearing on the execution of a particular estate, or some child law reason, DNA testing is one of the most accurate ways of picking up on genetic relationships which can provide the necessary proof for determining the correct legal outcome. As a result of its increased effectiveness over other methods of detection, nothing compares to DNA testing for accurately determining family relations.

Medical Use
Medical use is the other major field of practice for DNA testing. In medical situations, it can often be important to determine biological relationships in determining potential exposure to certain genetic conditions and in matching suitability for certain treatments. As medical research continues to advance, so too DNA testing becomes more high profile and more widely used in general practice as a far more conclusive way of identifying family relationships where is matters most.

"Curiosity" Testing
Whilst testing doesn't usually require maternal DNA samples, the at-home, or so-called Curiosity test is a good way to get peace of mind or to determine with some conclusivity whether or not you share a family relationship with another person - mostly a child. By testing oral swabs through a DNA testing kit normally sent to the client, the at-home testing is both easy to effect and accurate in producing results for determining DNA links where paternity is in question. For personal reasons or just for the sheer curiosity, the at-home test is far less controlled by protocol, but nevertheless can come up with accurate results where a particular relationship exists.

DNA testing is becoming more and more available, as the most accurate means of testing relationships. Where there is at least some degree of relationship, there is nothing more effective at determining genetic relationships than DNA testing, particularly in light of the advances in testing technology in recent years. From paternity testing through to siblingship testing and even grandparentage testing, using a DNA test can be a cost-effective and accurate way to determine whether or not alleged relationships do in fact exist. With that in mind, DNA testing should be your first choice of action should a family disputes arise on a biological relationship.

DNA Extraction

2011-11-02T20:02:00.001-07:00

DNA extraction, as the name suggests, is simply a process that results in separation of DNA from the cells or viruses that are hosting it. Though the meaning is simple, the process is not.

When we go into the peculiar details of DNA extraction, we realize that it’s more of an initial stage in other extensive DNA testing processes. DNA tests could be performed for any reason, however for any DNA testing to happen, the first stage normally is the isolation and extraction of DNA molecules from the cells that they reside in.

DNA extraction follows a series of steps, stripping all proteins from the DNA and the extraction protocols have to make sure that the DNA thus obtained via isolation and extraction is of high or acceptable quality.

There are plenty of industrial scale methods employed for DNA extraction including Large scale double-stranded DNA isolation, Midiprep double-stranded DNA isolation, Miniprep double-stranded DNA isolation etc.

While explaining these methods is beyond the scope of this article, the DNA extraction process in layman language could be broken down into the following steps:
1 – The first step is to break the cell that contains the DNA.

2 – Secondly, proteins that have long been associated with the DNA as well as other proteins belonging to the cell need to be cut off and completely removed. Certain salts are used in this step.

3 – Precipitate DNA with cold ethanol. Note that DNA doesn’t dissolve in alcohol and will retain its form, thus the alcohol only works as a washing agent to get rid of the salts added in last step.

4 – Dry the alcohol and test for the presence of DNA, perhaps via the electrophoresis process.

Again, it is important to have DNA with acceptable purity for further testing. This could be verified via testing for a scientific ratio. Any intolerable variance in this ratio means that DNA is still contaminated with the proteins it was supposed to get rid off via the extraction process.

DNA extraction equipment helps experts in the lab perform the necessary steps & procedure. While there are many tools and different types of machinery, the following are worth mentioning here:

Bead Beater – getting to the DNA is made possible by this one that actually breaks the cell.

Centrifuge – The DNA needs to be precipitated after being washed by ethanol for removal of cells.

Gel Box – Used in the DNA electrophoresis process that not only verifies the presence of DNA but also fragments it for further testing.

DNA Research – History

2011-11-02T20:01:00.001-07:00

The history of actively conducting DNA research goes all the way back to 1868, when Friedrich Miescher, a biologist from Sweden, worked out chemical research on the nuclei of cells. Not only did he find out a phosphorous containing material that he called nuclein, but he also pointed out the fact that this material consisted of two portions. One was an acidic segment, which is now known as DNA, while the other part was made up of proteins that packaged DNA.

However, it wasn’t until towards the end of 1940’s that the current picture of DNA emerged as a carrier of genetic information. Scientists working at the Rockefeller Institute, in 1943, based on their experiments concluded that DNA was responsible for transferring of genetic information, but they encountered resistance from other members of the bio community. Alfred Hershey and Martha Chase, in 1952, proved the case through a radioactive isotope tracer experiment.

Though Alfred Hershey’s DNA research had proved the case for DNA as the carrier of genetics information but the structure of this DNA and how it works was still a mystery. It was in 1953 that James Watson, an American genetics scientist, working together with Francis Crick, a physicist from England, came up with the double helix structure of DNA. This was a breakthrough piece in DNA research that has lead to much advancement in the field of genetic sciences. The two scientists also made use of DNA research that other scientists of that period had carried out and combining it with their own findings, they gave a very comprehensive picture of DNA structure.

Helping Watson and Crick build their double helix DNA model was the important DNA research carried out by Erwin Chargaff at Columbia University. Erwin discovered that while different organisms may have diverse proportions of nucleotide bases in their DNA, but the quantity of adenine will always be equal to thymine and guanine to cytosine. This led Watson and Crick to formulate that adenine always pair up with thymine and guanine with cytosine and hence are always present in same quantity.

DNA research has come a long way from these findings of 1950’s. Now things like DNA cloning are happening on commercial grounds. The mysteries of topics like DNA replication, DNA sequencing, DNA mutations etc have been well discovered too and what is left will not take too much time before it gets into human knowledge.

Mitochondrial DNA

2011-11-02T20:00:00.001-07:00

Cells in human body consist of many small organs or subunits that have specific functions. Mitochondria are one such subunit whose prime responsibility is to translate the energy received from food into a utilizable form for cells. However, unlike other subunits found in cells, mitochondria have genetic information of their own, which is known as Mitochindrial DNA.

Human beings have almost 16.500 base pairs of DNA that form the Mitochondrial DNA. However this is only a fraction of total DNA found in the cells of human body of which most is located within the nucleus in chromosomes.

All in all, there are 37 genes enclosed in the Mitochondrial DNA and in order for the Mitochondria of cells to function perfectly, all of these are of essence. According to the function that these genes present inside Mitochondrial DNA perform, they can be divided into two groups. The first group consists of 13 genes. These are responsible for providing the right directives for the production of enzymes that carry out oxidative phosphorylation, a process that produces the main supply of energy for the cell via making use of oxygen and sugar.

The second group of genes present in Mitochondrial DNA is responsible for laying out the foundations of a number of RNA molecules, transfer RNA’s and ribosomal RNA’s to be more precise. These RNA’s function similar to the DNA except the fact that they work outside the protected membrane and help in building proteins for the body.

It is interesting to note that Mitochondrial DNA can only be inherited from one’s mother. Though sons and daughters both inherit it from their mother, only daughters can pass it to their next generation.

A maternal lineage test, examines an individual’s biological relatedness to his or her maternal family. The test is conducted through a sequence analysis of Mitochondrial DNA.

The changes, also known as mutations, in the structure of Mitochondrial DNA are often associated with many diseases, of which cancer is also one. Factors that cause Somatic mutations, i.e. changes that are not inherited by the next generation, affect Mitochondrial DNA somewhat easily. This mutation may cause cancer affecting many parts of the body including liver, kidney, stomach etc as well as leukemia and lymphoma.

Somatic mutations attack the self-repairing mechanism of Mitochondrial DNA via the over production of dangerous molecules that are known as reactive oxygen species. It is these harmful molecules that Mitochondrial DNA is quite defenseless against.

DNA Electrophoresis

2011-11-02T19:59:00.001-07:00

With the advancement of DNA technology and the tools that are now available for scientists to interact with DNA, studying as well as testing the genetic code is getting more straightforward. Aiding the DNA testing is a process called DNA Electrophoresis that involves the separation of DNA fragments based on the difference in the sizes of these fragments. Back in 1970’s scientists had no option but to separate DNA fragments working tediously on principles of gravity.

Electrophoresis in DNA testing can be carried out via two popularly known methods.

First of these is the widely exercised Gel Electrophoresis method. This technique is based upon the fact that DNA fragments in a molecule are of different sizes by nature. DNA sample is placed inside a gel slab and is forced to travel via passing electric current. The direction of this fragment traveling is always from the negative to positive pole and since it’s easier for the smaller DNA fragments to move around the gel, these fragments start separating from each other as they travel with different speeds.

Experts are able to realize the characteristics of the DNA fragments by learning the distance that different fragments traveled within the gel.

For DNA molecules that are longer in shape, normally agarose gel is used for DNA electrophoresis. While polyacrylamide gel is utilized for the electrophoreses of DNA molecules composed of short lengths.

The second method used for DNA electrophoresis is Capillary Electrophoresis.

While it uses the same doctrine as gel electrophoresis, the basic difference is that instead of the slab format, DNA fragments are made to travel through a capillary.

The capillary, just like the slab in previous method, also contains gel. DNA sample is brought into the elongated & thin capillary that is full of gel, and current is passed through, again from negative to the positive pole. DNA fragments, owing to the difference in speed with which they travel through the extended capillary, start detaching from each other.

A key point to note in both the above methods is that the more time the experts give DNA fragments to move along the capillary or slab, by keeping the current to its minimum, the more precise will be the separation of DNA fragments. In order to measure and analyze the results of DNA electrophoresis, specialized software and solutions are available. As for the Capillary electrophoresis, the findings are presented in electropherogram.

DNA Synthesis

2011-11-02T19:56:00.000-07:00

With the advancement in biotechnology, we are now able to convert our knowledge of DNA, the chemicals and tools that are available, into an alternative way of fabricating genetic material. This is called DNA Synthesis.

Each individual DNA is basically made up of a special order of four nucleotides and the process of DNA synthesis, in layman language, is nothing but a reassembly of these individual nucleotides in a sequence that is compulsory for the preparation of particular genetic matter. DNA synthesizers allow one to input the right sequence of these nucleotides and act on this information to deliver the synthesized DNA.

The methodology for DNA synthesis was developed in early 1970’s. However, at that time, it was restricted to the production of oligonucleotides, which are diminutive DNA fragments and are classified as less than 200 nucleotides. The progression in DNA synthesis technology since then has resulted in our ability to manufacture DNA fragments as substantial as 50,000 nucleotides. These larger DNA’s are referred to as recombinant DNA. Together these two, i.e. oligonucleotides and recombinant DNA, build the classification for DNA synthesis industry.

Because of the high costs and other factors associated with DNA synthesis, only organizations or institutions that are actively serving the research groups involved in biotechnology actually pursue the DNA synthesis process.

DNA synthesis technology, quite rapidly, has been adopted in many industries and areas of human life. Projects have been undertaken to produce renewable energy biologically as well as biosynthesis of bulk and fine chemicals is carried out. Expansions are underway in fields ranging from biological information processing to agriculture, public health, medicine etc. Environment can be sensed, monitored and remedied via the advance and powerful techniques of DNA synthesis. Overall, we are in a much better position to understand and interact with the world around us.

However, not everything is good news regarding DNA synthesis. If the same technology goes into the hands of evil doers, individual and global biological security is threatened and at risk. Misapplication of DNA synthesis can lead towards the production of biological agents that are of troublesome nature and hazardous for human race at large.

While any restrictions on the employment of DNA synthesis technology will have adverse effects on its widespread popularity and means of achieving economies of scale, there is a serious need to develop a central security framework that makes sure that the technology is applied for the best of mankind and not for other purposes.

DNA Testing

2011-11-02T19:54:00.000-07:00

Where we come from?’ is not only an emotional query but can also be an important question to answer in many legal situations. With the emergence of tools and solutions that make use of converting the scientific and advanced DNA knowledge into practical applications one can use for discovering his or her heredity concerns, the commercial popularity of DNA testing has gone widespread.

DNA testing can be used in a wide variety of cases that range from parentage disputes and child support issues to identifying the genetic illness risks that one child may be carrying. Overall, DNA testing does a wonderful job of resolving issues scientifically and bringing peace of mind in our lives.

In this article, we are going to briefly cover the popular uses of DNA testing.

Paternity establishment is an important issue that can be solved via DNA testing. In layman language, the test will verify the paternity claim that a father has over his son or daughter. Apart from the uses of this test in disputes between couples, it can also be availed by a father to ensure that his offspring enjoys benefits such as Social Security, health insurance etc arising out of this relationship.

The paternity establishment tests, unless required by law enforcement agencies, can also be conducted in the comfort of one’s own house. You just have to follow the simple instructions and return the collecting kit to the commercial DNA testing company. The results will be delivered to you as discreetly as you instruct.

DNA testing can also be employed in the cases for child support. Even if the father of the child is missing, paternity can still be established via testing the DNA samples obtained from both of the grandparents.

Immigration is another area where DNA testing is widely adopted as a replacement of documents that prove biological relationships between family members.

The use of DNA testing in forensic investigations is simply momentous. In fact, the Federal Bureau of Investigation maintains a large database of DNA profiles, which could be referenced by various DNA labs to assist the law enforcement agencies in their search for the crime suspects.

A breakthrough in fight against the inherited diseases is Prenatal DNA Screening. This kind of DNA testing results in the identification of genetic diseases in a developing child. The known diseases or defects can either be prevented or managed depending upon the problem and available solutions.

DNA Replication Activities

2011-11-02T19:52:00.000-07:00

DNA replication involves many activities in the cell. These activities need to be performed gradually and very precisely, as any malfunction in the activities can appear in severe birth defects in offspring and can be fatal in some cases.

Availability of the following things is prerequisite for DNA replication activities to start:

· Original DNA to serve as an exact template

· Abundance and accessibility of nucleotides for pairing up with the template

· A sufficient energy source to initiate these activities, as bonds need to be broken. ATP (Adenosine Triphosphate - a compound produced in a cell that supplies energy for the cell’s activities) is that source

· Specific enzymes to help in these activities

First, among the DNA Replication activities, that launches the process is that a nick is formed by DNA gyrase. Unlike the C-G base pairs, the A-T base pairs have only two Hydrogen bonds holding them together; hence the location with an abundance of A-T bases is the ideal spot to crack the double helix with minimum energy required. This breaking up of hydrogen bonds, by the way, is an important movement in DNA replication. Uncoiling of the twisted double stranded DNA is carried out by helicase enzyme. This activity exposes bases in DNA.

As part of the DNA replication activities, DNA polymerase gets into the picture and enlarges each exposed strand by adding more nucleotides to it. The base-pairing rule is of course followed here.

In the elongation process, the original DNA strand is taken as a guide that DNA polymerase follows all the way. However, the DNA polymerase can only read this guide of DNA strand in 3’-5’ course and this causes a jumping of back and forth by DNA polymerase while reading and making way for RNA primers to be fastened to the strands. The replicated chain gets broken due to this jumping activity and Okazaki fragments are formed, which are nothing but minute parts of DNA.

Repair mechanism checks the errors in the new strands and removes the wrong nucleotides, replaces them by nucleases (enzymes). While DNA Ligase plugs the gaps in newly formed DNA strands.

Last among the DNA Replication activities is the curling up of new copies automatically.

It should also be noted that the time taken for these activities to pursue, varies in different kind of cells, and the processes within occur at different rates.

Steps of DNA Replication

2011-11-02T19:43:00.000-07:00

The next we have to do is to shed light into the mystery of the steps of DNA Replication of the Eykaryotes.

1)The first major step for the DNA Replication to take place is the breaking of hydrogen bonds between bases of the two antiparallel strands. The unwounding of the two strands is the starting point. The splitting happens in places of the chains which are rich in A-T. That is because there are only two bonds between Adenine and Thymine (there are three hydrogen bonds between Cytosine and Guanine). Helicase is the enzyme that splits the two strands. The initiation point where the splitting starts is called "origin of replication".The structure that is created is known as "Replication Fork".

2) One of the most important steps of DNA Replication is the binding of RNA Primase in the the initiation point of the 3'-5' parent chain. RNA Primase can attract RNA nucleotides which bind to the DNA nucleotides of the 3'-5' strand due to the hydrogen bonds between the bases. RNA nucleotides are the primers (starters) for the binding of DNA nucleotides.
3) The elongation process is different for the 5'-3' and 3'-5' template. a)5'-3' Template: The 3'-5' proceeding daughter strand -that uses a 5'-3' template- is called leading strand because DNA Polymerase ä can "read" the template and continuously adds nucleotides (complementary to the nucleotides of the template, for example Adenine opposite to Thymine etc).

b)3'-5'Template: The 3'-5' template cannot be "read" by DNA Polymerase ä. The replication of this template is complicated and the new strand is called lagging strand. In the lagging strand the RNA Primase adds more RNA Primers. DNA polymerase å reads the template and lengthens the bursts. The gap between two RNA primers is called "Okazaki Fragments".

The RNA Primers are necessary for DNA Polymerase å to bind Nucleotides to the 3' end of them. The daughter strand is elongated with the binding of more DNA nucleotides.
4) In the lagging strand the DNA Pol I -exonuclease- reads the fragments and removes the RNA Primers. The gaps are closed with the action of DNA Polymerase (adds complementary nucleotides to the gaps) and DNA Ligase (adds phosphate in the remaining gaps of the phosphate - sugar backbone).
Each new double helix is consisted of one old and one new chain. This is what we call semiconservative replication.

5) The last step of DNA Replication is the Termination. This process happens when the DNA Polymerase reaches to an end of the strands. We can easily understand that in the last section of the lagging strand, when the RNA primer is removed, it is not possible for the DNA Polymerase to seal the gap (because there is no primer). So, the end of the parental strand where the last primer binds isn't replicated. These ends of linear (chromosomal) DNA consists of noncoding DNA that contains repeat sequences and are called telomeres. As a result, a part of the telomere is removed in every cycle of DNA Replication.

6) The DNA Replication is not completed before a mechanism of repair fixes possible errors caused during the replication. Enzymes like nucleases remove the wrong nucleotides and the DNA Polymerase fills the gaps.

Similar processes also happen during the steps of DNA Replication of prokaryotes though there are some differences.

DNA replication

2011-11-02T19:27:00.000-07:00

DNA replication is a biological process that occurs in all living organisms and copies their DNA; it is the basis for biological inheritance. The process starts with one double-stranded DNA molecule and produces two identical copies of the molecule. Each strand of the original double-stranded DNA molecule serves as template for the production of the complementary strand. Cellular proofreading and error toe-checking mechanisms ensure near perfect fidelity for DNA replication.

In a cell, DNA replication begins at specific locations in the genome, called "origins". Unwinding of DNA at the origin, and synthesis of new strands, forms a replication fork. In addition to DNA polymerase, the enzyme that synthesizes the new DNA by adding nucleotides matched to the template strand, a number of other proteins are associated with the fork and assist in the initiation and continuation of DNA synthesis.

DNA replication can also be performed in vitro (artificially, outside a cell). DNA polymerases, isolated from cells, and artificial DNA primers are used to initiate DNA synthesis at known sequences in a template molecule. The polymerase chain reaction (PCR), a common laboratory technique, employs such artificial synthesis in a cyclic manner to amplify a specific target DNA fragment from a pool of DNA.

DNA structure
DNA usually exists as a double-stranded structure, with both strands coiled together to form the characteristic double-helix. Each single strand of DNA is a chain of four types of nucleotides having the bases: adenine, cytosine, guanine, and thymine. A nucleotide is a mono-, di-, or triphosphate deoxyribonucleoside; that is, a deoxyribose sugar is attached to one, two, or three phosphates. Chemical interaction of these nucleotides forms phosphodiester linkages, creating the phosphate-deoxyribose backbone of the DNA double helix with the bases pointing inward. Nucleotides (bases) are matched between strands through hydrogen bonds to form base pairs. Adenine pairs with thymine, and cytosine pairs with guanine.

DNA strands have a directionality, and the different ends of a single strand are called the "3' (three-prime) end" and the "5' (five-prime) end". These terms refer to the carbon atom in deoxyribose to which the next phosphate in the chain attaches. In addition to being complementary, the two strands of DNA are antiparallel: They are orientated in opposite directions. This directionality has consequences in DNA synthesis, because DNA polymerase can synthesize DNA in only one direction by adding nucleotides to the 3' end of a DNA strand.

The pairing of bases in DNA through hydrogen bonding means that the information contained within each strand is redundant. The nucleotides on a single strand can be used to reconstruct nucleotides on a newly synthesized partner strand.

DNA polymerase
DNA polymerases are a family of enzymes that carry out all forms of DNA replication. However, a DNA polymerase can only extend an existing DNA strand paired with a template strand; it cannot begin the synthesis of a new strand. To begin synthesis, a short fragment of DNA or RNA, called a primer, must be created and paired with the template DNA strand.

DNA polymerase then synthesizes a new strand of DNA by extending the 3' end of an existing nucleotide chain, adding new nucleotides matched to the template strand one at a time via the creation of phosphodiester bonds. The energy for this process of DNA polymerization comes from two of the three total phosphates attached to each unincorporated base. (Free bases with their attached phosphate groups are called nucleoside triphosphates.) When a nucleotide is being added to a growing DNA strand, two of the phosphates are removed and the energy produced creates a phosphodiester bond that attaches the remaining phosphate to the growing chain. The energetics of this process also help explain the directionality of synthesis - if DNA were synthesized in the 3' to 5' direction, the energy for the process would come from the 5' end of the growing strand rather than from free nucleotides.

In general, DNA polymerases are extremely accurate, making less than one mistake for every 107 nucleotides added. Even so, some DNA polymerases also have proofreading ability; they can remove nucleotides from the end of a strand in order to correct mismatched bases. If the 5' nucleotide needs to be removed during proofreading, the triphosphate end is lost. Hence, the energy source that usually provides energy to add a new nucleotide is also lost.

Replication process

Origins

For a cell to divide, it must first replicate its DNA. This process is initiated at particular points in the DNA, known as "origins", which are targeted by proteins that separate the two strands and initiate DNA synthesis. Origins contain DNA sequences recognized by replication initiator proteins (e.g., dnaA in E. coli' and the Origin Recognition Complex in yeast). These initiator proteins recruit other proteins to separate the two strands and initiate replication forks.

Initiator proteins recruit other proteins to separate the DNA strands at the origin, forming a bubble. Origins tend to be "AT-rich" (rich in adenine and thymine bases) to assist this process, because A-T base pairs have two hydrogen bonds (rather than the three formed in a C-G pair)—in general, strands rich in these nucleotides are easier to separate because a greater number of hydrogen bonds requires more energy to break them. Once strands are separated, RNA primers are created on the template strands. To be more specific, the leading strand receives one RNA primer per active origin of replication while the lagging strand receives several; these several fragments of RNA primers found on the lagging strand of DNA are called Okazaki fragments, named after their discoverer. DNA Polymerase extends the leading strand in one continuous motion and the lagging strand in a discontinuous motion (due to the Okazaki fragments). RNase removes the RNA fragments used to initiate replication by DNA Polymerase, and another DNA Polymerase enters to fill the gaps. When this is complete, a single nick on the leading strand and several nicks on the lagging strand can be found. Ligase works to fill these nicks in, thus completing the newly replicated DNA molecule.

As DNA synthesis continues, the original DNA strands continue to unwind on each side of the bubble, forming a replication fork with two prongs. In bacteria, which have a single origin of replication on their circular chromosome, this process eventually creates a "theta structure" (resembling the Greek letter theta: θ). In contrast, eukaryotes have longer linear chromosomes and initiate replication at multiple origins within these.

Replication fork
The replication fork is a structure that forms within the nucleus during DNA replication. It is created by helicases, which break the hydrogen bonds holding the two DNA strands together. The resulting structure has two branching "prongs", each one made up of a single strand of DNA. These two strands serve as the template for the leading and lagging strands, which will be created as DNA polymerase matches complementary nucleotides to the templates; The templates may be properly referred to as the leading strand template and the lagging strand template.

Leading strand

The leading strand is the template strand of the DNA double helix so that the replication fork moves along it in the 3' to 5' direction. This allows the newly synthesized strand complementary to the original strand to be synthesized 5' to 3' in the same direction as the movement of the replication fork.

On the leading strand, a polymerase "reads" the DNA and adds nucleotides to it continuously. This polymerase is DNA polymerase III (DNA Pol III) in prokaryotes and presumably Pol ε in yeasts. In human cells the leading and lagging strands are synthesized by Pol α and Pol δ within the nucleus and Pol γ in the mitochondria. Pol ε can substitute for Pol δ in special circumstances.

Lagging strand

The lagging strand is the strand of the template DNA double helix that is oriented so that the replication fork moves along it in a 5' to 3' manner. Because of its orientation, opposite to the working orientation of DNA polymerase III, which moves on a template in a 3' to 5' manner, replication of the lagging strand is more complicated than that of the leading strand.

On the lagging strand, primase "reads" the DNA and adds RNA to it in short, separated segments. In eukaryotes, primase is intrinsic to Pol α. DNA polymerase III or Pol δ lengthens the primed segments, forming Okazaki fragments. Primer removal in eukaryotes is also performed by Pol δ. In prokaryotes, DNA polymerase I "reads" the fragments, removes the RNA using its flap endonuclease domain (RNA primers are removed by 5'-3' exonuclease activity of polymerase I [weaver, 2005], and replaces the RNA nucleotides with DNA nucleotides (this is necessary because RNA and DNA use slightly different kinds of nucleotides). DNA ligase joins the fragments together.

Dynamics at the replication fork
As helicase unwinds DNA at the replication fork, the DNA ahead is forced to rotate. This process results in a build-up of twists in the DNA ahead. This build-up would form a resistance that would eventually halt the progress of the replication fork. DNA topoisomerases are enzymes that solve these physical problems in the coiling of DNA. Topoisomerase I ngle backbone on the DNA, enabling the strands to swivel around each other to remove the build-up of twists. Topoisomerase II cuts both backbones, enabling one double-stranded DNA to pass through another, thereby removing knots and entanglements that can form within and between DNA molecules.

Bare single-stranded DNA tends to fold back on itself and form secondary structures; these structures can interfere with the movement of DNA polymerase. To prevent this, single-strand binding proteins bind to the DNA until a second strand is synthesized, preventing secondary structure formation.

Clamp proteins form a sliding clamp around DNA, helping the DNA polymerase maintain contact with its template, thereby assisting with processivity. The inner face of the clamp enables DNA to be threaded through it. Once the polymerase reaches the end of the template or detects double-stranded DNA, the sliding clamp undergoes a conformational change that releases the DNA polymerase. Clamp-loading proteins are used to initially load the clamp, recognizing the junction between template and RNA primers.

Regulation

Eukaryotes

Within eukaryotes, DNA replication is controlled within the context of the cell cycle. As the cell grows and divides, it progresses through stages in the cell cycle; DNA replication occurs during the S phase (synthesis phase). The progress of the eukaryotic cell through the cycle is controlled by cell cycle checkpoints. Progression through checkpoints is controlled through complex interactions between various proteins, including cyclins and cyclin-dependent kinases.

The G1/S checkpoint (or restriction checkpoint) regulates whether eukaryotic cells enter the process of DNA replication and subsequent division. Cells that do not proceed through this checkpoint are remain in the G0 stage and do not replicate their DNA.

Replication of chloroplast and mitochondrial genomes occurs independent of the cell cycle, through the process of D-loop replication.
Bacteria

Most bacteria do not go through a well-defined cell cycle but instead continuously copy their DNA; during rapid growth, this can result in the concurrent occurrences of multiple rounds of replication. In E. coli, the best-characterized bacteria, DNA replication is regulated through several mechanisms, including: the hemimethylation and sequestering of the origin sequence, the ratio of ATP to ADP, and the levels of protein DnaA. All these control the process of initiator proteins binding to the origin sequences.

Because E. coli methylates GATC DNA sequences, DNA synthesis results in hemimethylated sequences. This hemimethylated DNA is recognized by the protein SeqA, which binds and sequesters the origin sequence; in addition, dnaA (required for initiation of replication) binds less well to hemimethylated DNA. As a result, newly replicated origins are prevented from immediately initiating another round of DNA replication.

ATP builds up when the cell is in a rich medium, triggering DNA replication once the cell has reached a specific size. ATP competes with ADP to bind to DnaA, and the DnaA-ATP complex is able to initiate replication. A certain number of DnaA proteins are also required for DNA replication — each time the origin is copied, the number of binding sites for DnaA doubles, requiring the synthesis of more DnaA to enable another initiation of replication.

Termination

Eukaryotes initiate DNA replication at multiple points in the chromosome, so replication forks meet and terminate at many points in the chromosome; these are not known to be regulated in any particular way. Because eukaryotes have linear chromosomes, DNA replication is unable to reach the very end of the chromosomes, but ends at the telomere region of repetitive DNA close to the end. This shortens the telomere of the daughter DNA strand. This is a normal process in somatic cells. As a result, cells can only divide a certain number of times before the DNA loss prevents further division. (This is known as the Hayflick limit.) Within the germ cell line, which passes DNA to the next generation, telomerase extends the repetitive sequences of the telomere region to prevent degradation. Telomerase can become mistakenly active in somatic cells, sometimes leading to cancer formation.

Because bacteria have circular chromosomes, termination of replication occurs when the two replication forks meet each other on the opposite end of the parental chromosome. E coli regulate this process through the use of termination sequences that, when bound by the Tus protein, enable only one direction of replication fork to pass through. As a result, the replication forks are constrained to always meet within the termination region of the chromosome.

Polymerase chain reaction
Researchers commonly replicate DNA in vitro using the polymerase chain reaction (PCR). PCR uses a pair of primers to span a target region in template DNA, and then polymerizes partner strands in each direction from these primers using a thermostable DNA polymerase. Repeating this process through multiple cycles produces amplification of the targeted DNA region. At the start of each cycle, the mixture of template and primers is heated, separating the newly synthesized molecule and template. Then, as the mixture cools, both of these become templates for annealing of new primers, and the polymerase extends from these. As a result, the number of copies of the target region doubles each round, increasing exponentially.

Taxonomic systems

2011-09-20T08:46:00.000-07:00

The initiation for eolving taxonomic systems was provided by Aristotle (384-322 BC). He emphasized that animals can be classified according to their way of living, actions, habits and body parts. He observed insects, fishes, birds and whales. The insect orders like Coleoptera, Diptera were created by him. Due to his contributions, he is considered as the ‘father of biological classification’.

For modern taxonomy, the first work was carried out by John Ray (1627 - 1705) of England. His most interesting systematic work ‘Synopsis Methodica Animalium Quadrupedum et Serpentini Generis’ was published in 1693. He divided animals into those with blood and those without blood. He also classified animals based on gills, lungs, claws, teeth and other structures. He provided the first good definition of the species as ‘a reproducing unit’.

The great Swedish naturalist Linnaeus (Caroli Linnaei) (1707 - 1778) exerted an important influence on further advancement in taxonomy. Hence he has been called the father of taxonomy. In 1758 he published his famous book, systema naturae. He first introduced the hierarchic system, both in animal and plant kingdoms. He followed four categories namely class, order, genus, species for the animal world. His greatest contribution to taxonomy was the use of binomial nomenclature for all species of animals and plants.

Michael Adamson (1727 - 1806), a French botanist, stressed that classification should be based on as many characters as possible. His concept helped to develop a new type of taxonomy called ‘Numerical Taxonomy’. Lamarck (1744 - 1829) made the first attempt to improve Linnaen
system. He published seven volumes of his ‘Histoire Naturelle des Animaux sans Vertebres’. He arranged animals according to evolution. He displayed the groups of animals in the form of a branching tree. It was the beginning of the use of phylogeny in systematics.

Cuvier (1769 - 1832) insisted that extinct fossil forms should be included in the table of classification. He divided animals into four branches. They are Vertebrata-fishes to mammals, Mollusca-mollusca and barnacles, Articulata-annelids, crustaceans, insects and spiders and Radiataechinoderms, nematodes and coelenterates.

Charles Darwin in 1859, published his famous work ‘Origin of species’. The new evolutionary concept of Darwin had an immediate acceptance among biologists. Due to the influence of evolutionary ideas, taxonomy was studied as an important evidence in favour of evolution.
The taxonomists were encouraged to learn that evolution theory of Darwin gave meaning to their classifying activities. A large number of species were discovered and described.
The development of modern taxonomy started during 1930s. During this period taxonomy was based on population studies.

E. Mayr (1942) considered species as “groups of interbreeding natural populations”.
His book ‘New Systematics’ became a landmark in the history of taxonomy. The taxonomists were forced to accept species as a ‘population’. Hence the taxonomist started moving from the laboratory to the field. Morphological characters were studied along with other characters as behaviour, sound, ecology, genetics, zoogeography, physiology and biochemistry. Thus taxonomy was transformed into ‘biological taxonomy’.

Application and Uses of Recombinant DNA Technology

2011-09-20T08:42:00.000-07:00

1. Genetic engineering/recombinant DNA technology has enabled the understanding of structure of eukaryotic genes and their components.
2. Genetically engineered bacteria are employed to synthesize certain vital life saving drugs, hormones and antibiotics eg., Antiviral / anticancer interferons ; human growth hormone (HGH) somatostatin, etc.
3. Through recombinant DNA technology, the gene types of plants are altered. New transgenic plants which are resistant to diseases and pest attack have been produced.
4. Genetic defects in animals as well as human could be corrected through gene therapy.
5. Genetically engineered bacteria are called superbugs. Superbugs can degrade several aromatic hydrocarbons, at the same time. They are employed in clearing oil spills in the ocean. Thus these are used in pollution abatement. The super bug was produced first by an Indian researcher Anand Chakrabarthy in USA. He developed a strain of Pseudomona bacterium to clear up oil spills. The above superbug can destroy octanes, xylenes camphors and toluenes.

Transgenic organisms

2011-09-20T08:36:00.000-07:00

Genetically Modified Organisms (GMOs)
In genetic engineering, the methods of gene transfer lead to the production of transgenic animals and plants. These are called genetically modified organisms. Transgenism has been recognized as one of the thrust areas of biotechnology.

Gene transfer Methods
The uptake of genes by the cells in animals is called trans fection. The transfected cells are used for a variety of purposes such as
1. Theproduction of chemicals and pharmaceutical drugs, 2. Study of structure and function of genes and 3. Production of transgenic animals of commercial value such as livestock animals and fishes. It is also called molecular farming. In transfection, fertilized eggs/embryos or the cultured cells are employed.

Transfer of genes to Fertilized eggs or embryos
The transfection of fertilized egg involves either the transfer of whole nuclei or whole chromosomes; or their fragments or the DNA segments.

A. For the transfer of whole nuclei, the cells are treated with cytochalasin B and enucleated. The enucleated cells are incubated with the desired karyoplasts (nuclei) for induction in presence of polyethylene glycol (PEG).
B. For transfer of whole chromosomes, metaphase cells are subjected to hypotonic lysis and individual chromosomes or fragments are isolated and then incubated with whole cells/eggs for transfection.
C. Microinjection of DNA segments : In this the fertilized eggs are injected
with DNA segments for integration. DNA integrated eggs are then used for getting transgenic animals.
D. Transfer of genes to cultured cells : In this stem cells are used. The stem cells are undifferentiated precursor cells. In these cultured cells, the gene can be delivered through vectors like retroviruses or directly by techniques such as microinjection using particle gun, electroporation or by the use of liposomes.

Transgenic animals have been produced in a variety of animals such as mice, rabbits, sheeps, pigs, goats, cows, fishes etc.

Uses:
1. Transgenic animals are more efficient than their normal counterpart in feed assimilation.
2. They exhibit faster growth and hence achieve the marketable size sooner.
3. Meat quality is good.
4. They are resistant to certain diseases.
5. They serve as bioreactors for obtaining valuable recombinant
proteins and pharmaceuticals from their milk or urine or blood.

Ethical Issues, Merits and Demerits of cloning

2011-09-20T08:34:00.001-07:00

1. Cloning of animals is considered as an unethical and unnatural technique by some people.
2. It is feared that attempts to clone human may lead to the birth/production of wrong persons.
3. Cloning cannot produce children like the children born to genetic mothers.Variations in traits are bound to appear.
4. When organisms are created by cloning from somatic cells of the adult, the longevity of the new born, disease tolerance capacity are some criteria to be considered. Cloned animals have also developed diseases like arthritis.
5. Cloning also leads to wastage of egg cells. In the cloning of Cat, 200 egg cells were used and 57 were implanted. Out of that only one cloned cat survived to birth.
6. Cloned animals may have health problems. They may die at a much earlier age than the rest of the species. So cloned animals from somatic cells of adult, may have short life span.
7. Among the benefits of cloning, special mention should be made regarding its role in biodiversity. Cloning will help to maintain biodiversity. It can bring back even the animals which have become extinct recently and safe guard all endangered species facing extinction.
8. Though human cloning has its own ethical problems, the principle could be used to grow new organs from the cloned stem cells. Such organ culture may solve transplantation problems, such as tissue

Structure and Function of Bacterial Cells

2011-07-16T19:53:00.000-07:00

Primary Structure of Biological Macromolecules Determines Function

Procaryotic structural components consist of macromolecules such as DNA, RNA, proteins, polysaccharides, phospholipids, or some combination thereof. The macromolecules are made up of primary subunits such as nucleotides, amino acids and sugars (Table 1). It is the sequence in which the subunits are put together in the macromolecule, called the primary structure, that determines many of the properties that the macromolecule will have. Thus, the genetic code is determined by specific nuleotide base sequences in chromosomal DNA; the amino acid sequence in a protein determines the properties and function of the protein; and sequence of sugars in bacterial lipopolysaccharides determines unique cell wall properties for pathogens. The primary structure of a macromolecule will drive its function, and differences within the primary structure of biological macromolecules accounts for the immense diversity of life.

Table 1. Macromolecules that make up cell material

Macromolecule	Primary Subunits	Where found in cell
Proteins	amino acids	Flagella, pili, cell walls, cytoplasmic membranes, ribosomes, cytoplasm
Polysaccharides	sugars (carbohydrates)	capsules, inclusions (storage), cell walls
Phospholipids	fatty acids	membranes
Nucleic Acids (DNA/RNA)	nucleotides	DNA: nucleoid (chromosome), plasmids rRNA: ribosomes; mRNA, tRNA: cytoplasm

Procaryotic Cell Architecture

At one time it was thought that bacteria and other procaryotes were essentially "bags of enzymes" with no inherent cellular architecture. The development of the electron microscope in the 1950s revealed the distinct anatomical features of bacteria and confirmed the suspicion that they lacked a nuclear membrane. Procaryotes are cells of relatively simple construction, especially if compared to eucaryotes. Whereas eucaryotic cells have a preponderance of organelles with separate cellular functions, procaryotes carry out all cellular functions as individual units.

A procaryotic cell has five essential structural components: a nucleoid (DNA), ribosomes, cell membrane, cell wall, and some sort of surface layer, which may or may not be an inherent part of the wall.

Structurally, there are three architectural regions: appendages (attachments to the cell surface) in the form of flagella and pili (or fimbriae); a cell envelope consisting of a capsule, cell wall and plasma membrane; and a cytoplasmic region that contains the cell chromosome (DNA) and ribosomes and various sorts of inclusions (Figure 1).

Figure 1. Cutaway drawing of a typical bacterial cell illustrating structural components. See Table 2 below for chemical composition and function of the labeled components.

Table 2. Summary of characteristics of typical bacterial cell structures

Structure Flagella	Function(s) Swimming movement	Predominant chemical composition Protein
Pili
Sex pilus	Stabilizes mating bacteria during DNA transfer by conjugation	Protein
Common pili or fimbriae	Attachment to surfaces; protection against phagotrophic engulfment	Protein
Capsules (includes "slime layers" and glycocalyx)	Attachment to surfaces; protection against phagocytic engulfment, occasionally killing or digestion; reserve of nutrients or protection against desiccation	Usually polysaccharide; occasionally polypeptide
Cell wall
Gram-positive bacteria	Prevents osmotic lysis of cell protoplast and confers rigidity and shape on cells	Peptidoglycan (murein) complexed with teichoic acids
Gram-negative bacteria	Peptidoglycan prevents osmotic lysis and confers rigidity and shape; outer membrane is permeability barrier; associated LPS and proteins have various functions	Peptidoglycan (murein) surrounded by phospholipid protein-lipopolysaccharide "outer membrane"
Plasma membrane	Permeability barrier; transport of solutes; energy generation; location of numerous enzyme systems	Phospholipid and protein
Ribosomes	Sites of translation (protein synthesis)	RNA and protein
Inclusions	Often reserves of nutrients; additional specialized functions	Highly variable; carbohydrate, lipid, protein or inorganic
Chromosome	Genetic material of cell	DNA
Plasmid	Extrachromosomal genetic material	DNA

Figure 2 . Electron micrograph of an ultra-thin section of a dividing pair of group A streptococci (20,000X). The cell surface fimbriae (fibrils) are evident. The bacterial cell wall is seen as the light staining region between the fibrils and the dark staining cell interior. Cell division in progress is indicated by the new septum formed between the two cells and by the indentation of the cell wall near the cell equator. The streptococcal cell diameter is equal to approximately one micron.

Synthesis of DNA By Chemical Method

2011-07-16T19:49:00.001-07:00

DNA can be synthesized artificially in a test tube by chemical process instead of using biological synthesis. The process of synthesizing a short stretch of DNA by using a chemical reaction is called as chemical DNA method.

Machines that automate the chemical reaction involved in DNA synthesis which can synthesize a single strand. when the sequence and chemicals are provided, are called as gene machines or DNA synthesizers.

A DNA synthesizer consists of a set of valves and pumps that are programmed to introduce specific nucleotides and the reagents required for the coupling of each consecutive nucleotide to the growing chain. Chemical DNA synthesis does not follow the biological direction of DNA synthesis.

In the chemical process each incoming DNA is added to the 5 '-hydroxyl terminus of the growing chain. These processes of adding are controlled by computer and are carried in a single reaction vessel that is a column, so that reagents from one reaction step can be readily washed away before the reagents for the next step are added and the reagents can be used in excess to drive the reactions as close as possible to compilation.

Applications of DNA Sequencing

2011-07-16T19:47:00.000-07:00

1. DNA sequencing information is important for planning the procedure and method of gene manipulation. 2. DNA sequencing is used for construction of restriction endonuclease map. 3. It is used to find tandem repeats or inverted repeat for the possibility of hairpin formations.
4. The sequences can be used to find whether any open reading frame (ORF) coding for a polypeptide exists. 5. DNA sequences can be used to find a polypeptide sequence from the data bank or to compare with DNA sequences from other animals for phylogenetic analysis. 6. They are used to construct the molecular evolution map. 7. They are useful in identifying exons and introns.

Emerging technologies in DNA sequencing

2011-07-16T19:41:00.000-07:00

Demand for DNA sequence information has never been greater, yet current Sanger technology is too costly, time consuming, and labor intensive to meet this ongoing demand. Applications span numerous research interests, including sequence variation studies, comparative genomics and evolution, forensics, and diagnostic and applied therapeutics. Several emerging technologies show promise of delivering next-generation solutions for fast and affordable genome sequencing. In this review article, the DNA polymerase-dependent strategies of Sanger sequencing, single nucleotide addition, and cyclic reversible termination are discussed to highlight recent advances and potential challenges these technologies face in their development for ultrafast DNA sequencing.

More than just a mapping and sequencing endeavor, the Human Genome Project (HGP) has altered the mindset and approach to many basic and applied research efforts. Early skepticism and controversy (Koshland 1989; Luria et al. 1989; Roberts 1989b; Fox et al. 1990) were soon laid to rest by well-developed strategies (Roberts 1989a; Collins and Galas 1993; Collins et al. 1998) that led to the successful execution of mankind's largest biology project. At the core of the HGP was technology development that advanced the pace of sequencing a mammalian-size genome from years to months. Along the way, numerous strategies emerged that hold promise for rapid, efficient, and inexpensive delivery of DNA sequence information. For the HGP, a brute-force approach was adopted for completing the job by coupling the core technologies of Sanger sequencing and fluorescence detection. The completion of the sequencing phase could not have been accomplished without major innovations in recombinant protein engineering, fluorescent dye development, capillary electrophoresis, automation, robotics, informatics, and process management. The result was completion of a high-quality, reference sequence of the human genome in April, 2003 (Collins et al. 2003), marking the 50-year anniversary of the discovery of the double-helix structure. For many outside the genome community, that heroic milestone signaled the end of this international scientific project, but for the rest of us, it only marked the beginning of things to come.

The need for sequencing has never been greater than it is today, with applications spanning diverse research sectors including comparative genomics and evolution, forensics, epidemiology, and applied medicine for diagnostics and therapeutics. Arguably, the strongest rationale for ongoing sequencing is the quest for identification and interpretation of human sequence variation as it relates to health and disease. The most common form of variation is the single nucleotide polymorphism (SNP). Although two unrelated people share, on average, 99.9% sequence identity (i.e., one difference in a thousand base pairs), the average occurrence of an SNP in the general population is once every few hundred base pairs. As such, more than nine million unique SNPs have been cataloged in the public database, dbSNP (Crawford and Nickerson 2005), with many more expected to be found in large-scale resequencing efforts.

A great deal of attention has been focused on common SNPs with a minor allele frequency >5% and their potential role in common disease (Lander 1996; Risch and Merikangas 1996; Collins et al. 1997). Recent, large-scale genotyping efforts of these common SNPs have shown that much of the human genome can be parsed into common haplotype blocks (Daly et al. 2001; Patil et al. 2001; Gabriel et al. 2002). The International HapMap Consortium (2003) was formed to characterize common patterns of sequence variation by determining allele frequencies and the degree of association between SNPs among geographically distinct groups, leading to the identification of “tagSNPs” for genome-wide, disease-based association studies. With this method of characterization, however, rare SNPs/haplotypes may be overlooked, as highlighted by Liu et al. (2005), who described an association of rare variants/haplotypes with osteoporosis.

A shift in large-scale strategies from genotyping to resequencing is currently taking place to explore the significance of less-common SNPs to human biology and disease. The “re” in this approach is the sequencing of additional genomes related to a reference genome for de novo SNP discovery and comparative genomics application. The ENCODE Project Consortium (2004) has described significant efforts toward resequencing megabase-sized blocks of the human genome. Consequently, genome centers are now diverting at least 10%-20% of their resources, which currently translates to ∼5% capacity, to resequencing hundreds to thousands of gene regions. This increase in momentum for high-throughput resequencing will greatly facilitate studies to determine the genetic basis of susceptibility to common disease, cancer biology, and disease association in model and nonmodel organisms.

Current sequencing technologies are too expensive, labor intensive, and time consuming for broad application in human sequence variation studies. Genome center cost is calculated on the basis of dollars per 1000 Q20 bases (defined below) and can be generally divided into the categories of instrumentation, personnel, reagents and materials, and overhead expenses. Currently, these centers are operating at less than one dollar per 1000 Q20 bases, with at least 50% of the cost resulting from DNA sequencing instrumentation alone. Developments in novel detection methods, miniaturization in instrumentation, microfluidic separation technologies, and an increase in the number of assays per run will most likely have the biggest impact on reducing cost. It should be emphasized, however, that new sequencing strategies will be needed to use these high-throughput platforms effectively. In September, 2004, the National Human Genome Research Institute (NHGRI) initiated two new programs aimed at bringing the cost of whole-genome sequencing down to $100,000 (http://grants.nih.gov/grants/guide/rfa-files/RFA-HG-04-002.html), with the eventual goal being $1000 (http://grants.nih.gov/grants/guide/rfa-files/RFA-HG-04-003.html).

Numerous strategies and platforms for ultrafast DNA sequencing currently under development include sequencing-by-hybridization (SBH), nanopore sequencing, and sequencing-by-synthesis (SBS), the latter of which encompasses many different DNA polymerase-dependent strategies. Use of the term SBS has become increasingly ambiguous in the literature; therefore, I propose a classification of DNA polymerase-dependent strategies into three major categories: Sanger sequencing, single nucleotide addition (SNA), and cyclic reversible termination (CRT) (Text Box 1). In this review, I will focus only on DNA polymerase-dependent strategies, which represent the broadest area of research and development. For the SNA and CRT strategies, I will emphasize the chemistry in an effort to illustrate the advantages and challenges of these methods. Because of the competitive nature of technology development, the exchange of scientific ideas is often thwarted, as many companies do not readily publish results. Although this review will highlight recent advances reported in the literature, readers are directed to the Web sites of companies who are active in the sequencing field (Table 1). A recent review by Shendure et al. (2004) provides a comprehensive overview of SBH and nanopore sequencing technologies. Important issues surrounding whole-genome sequencing, such as ownership, consent, privacy, and legal, ethical, and social implications, will not be addressed here (Foster and Sharp 2002; Robertson 2003; Bonham et al. 2005).

A brief guide to DNA sequencing

2011-07-16T19:12:00.000-07:00

It's rare for a month to go by without some aspect of DNA sequencing making the headlines. Species after species has seen its genome completed, and the human genome, whether it's from healthy individuals or cancer cells, has received special attention. A dozen or more companies are attempting to bring new sequencing technology to market that could eventually drop the cost of sequencing down to the neighborhood of a new laptop. Arguably, it's one of the hottest high-tech fields on the planet.

But, although these methods can differ, sometimes radically, in how they obtain the sequence of DNA, they're all fundamentally constrained by the chemistry of DNA itself, which is remarkably simple: a long chain of alternating sugars and phosphates, with each sugar linked to one of four bases. Because the chemistry of DNA is so simple, the process of sequencing it is straightforward enough that anyone with a basic understanding of biology can probably understand the fundamentals. The new sequencing hardware may be very complex, but all the complexity is generally there to just sequence lots of molecules in parallel; the actual process remains pretty simple.

In a series of articles, we'll start with the very basics of DNA sequencing, and build our way up to the techniques that were used to complete the human genome. From there, we'll spend time on the current crop of "next-generation" sequencing hardware, before going on to examine some of the more exotic things that may be coming down the pipeline within the next few years.

The basics of copying DNA

Anyone who's made it through biology knows a bit about the structure of the double helix. Half of one is shown above, to illustrate its three components: its backbone is made up of alternating sugars (blue) and phosphates (red), and each sugar is linked to one of four bases (green). In this case, all of the bases shown are adenine (A), although they could be potentially be guanine (G), cytosine (C), or thymine (T). In the double helix, the bases undergo base pairing to partners on the opposite strand: A with T, C with G.

When a cell divides and DNA needs to be replicated, the double helix is split, and enzymes called polymerases use each of the two halves as a template for an new opposing strand; the base pairing rules ensure that the copying is exact, except for rare errors. Historically, DNA sequencing has relied on the exact same process of copying DNA—in fact, the enzymes that make copies of DNA within a cell are so efficient that biologists have used a modified polymerase to perform sequencing.

In the animation shown at right, a string of T's is base paired with a partial complement of A's on an opposing strand. The DNA

polymerase, which isn't shown, is able to add additional nucleotides (a sugar + base combination) under two conditions: they're in the "triphosphate" form, with three phosphate groups in a row, and they base pair successfully with the complementary strand. As the red highlight indicates, the polymerase causes the hydroxyl group (OH) at the end of the existing strand to react with the triphosphate, linking the two together as part of the growing chain. When that reaction is done, there's a new hydroxyl group ready to react, allowing the cycle to continue. By moving down the strand and repeating this reaction, a new molecule of DNA with a specific sequence is created.

From copying to sequencing

From a sequencing perspective, having a new copy of DNA isn't especially helpful. What we want to know is what the order of the bases along the strand is. Sequencing works because we can get the process to stop in specific places and identify the base where it stops.

The simplest way to do this is to mess with the chemistry. Instead of supplying the DNA with a normal nucleotide, it's possible to synthesize one without the hydroxyl group that the polymerase uses to add the next base. As the animation here shows, the base can be added to the growing strand normally, but, once in place, the process comes to a crashing halt. We've now stopped the process of DNA replication.

Of course, if you supply the polymerase with nothing but terminating bases, it will never get very far.

So, for a sequencing reaction, researchers use a mix of nucleotides where the majority are normal but a small fraction lack the hydroxyl group. Now, most of the time, the polymerase adds a normal nucleotide, and the reaction continues. But, at a certain probability, a terminator will be put in place, and the reaction stops. If you perform this reaction with lots of identical DNA molecules, you'll wind up with a distribution of lengths that slowly tails off as fewer and fewer unterminated molecules are left. The point at which this tailing off takes place is dictated by the fraction of terminator nucleotides in the reaction mix.

Now we just need to know what base is present when the reaction stops. This is possible by making sure that only one of the four nucleotides given to the polymerase can terminate the reaction. If all the C's, T's and G's are normal, but some fraction of the A's are terminators, then that reaction will produce a population of DNA molecules that all end at A. By setting up four reactions, one for each base, it's possible to identify the base at every position.

There are only two more secrets to DNA sequencing. First, you need to make sure every polymerase starts copying in the same place, otherwise you'll have a collection of molecules with two randomly located ends. This part is easy, since DNA polymerases can only add nucleotides to an existing strand. So, researchers can "prime" the polymerase by seeding the reaction with a short DNA molecule that base pairs with a known sequences that's next to the one you want to determine.

The other trick is that you need to figure out how long each DNA molecule is in the large mix of reaction products that you're left with. The negative charge on phosphates makes this easy, since it ensures that DNA molecules will move when placed in an electric field. So, if you start the reaction mix on one side of an aqueous polymer mesh (called a gel) and run a current through the solution, the DNA will worm its way through the mesh. Shorter molecules move faster, longer ones slower, allowing the population of molecules to be separated based on their sizes. By running the four reactions down neighboring lanes on a gel, you'll get a pattern that looks like the one below, which can be read off to determine the sequence of the DNA molecule.

DNA sequencing. Given a supply of DNA molecules and primers, the polymerase makes a series of fragments that stop when a terminating base is incorporated. The fragments appear as bands in one of the four lanes that run across the gel at bottom.

Going high(er) throughput

We're now at the state of the art from when I was a graduate student back in the early 1990s and, trust me, it was anything but artful. The presence of the DNA, marked by those dark bands, came from a short-lived radioisotope incorporated into the nucleotides. That meant you had to collect everything involved in the process and pay someone to store it until it decayed to background. The gels were flexible enough that they would shift or bend at the slightest provocation, making the order of bases difficult to read. But not so flexible that they wouldn't tear if suitably disturbed. All told, it took a full day to create something from which, if you were lucky, you could read two hundred bases down each lane, making each gel good for about a kilobase of sequence.

The human genome is about 3 Gigabases—clearly, this wasn't going to cut it, and people were beginning to discuss all manners of exotic approaches, like reading single molecules with a scanning-tunneling microscope.

Fortunately, a couple of changes breathed new life into the old approach. For starters, people got rid of the radioactivity by replacing it with a fluorescent tag. Not only was this a whole lot more convenient, but it enabled a simple four-fold improvement in throughput. Go to any outdoor event, and the glow sticks should indicate that it's possible to craft molecules that fluoresce in a variety of different colors.

By picking four fluorescent molecules that are decently spread out—blue for G's, green for A's, Yellow for T's and red for C's, for example—and linking them to a specific terminating nucleotide, it's possible to link the termination position with the identity of the base there. What once required four separate reactions could now be run at once in a single solution.

The next trick was to get rid of most of the gel. As we noted above, molecules work their way through the gel based on their size, but you needed a long gel if you wanted to image a lot of them at once. The solution, it turned out, was not to image them at once—something that, before the switch from radioactivity to fluorescence, wasn't really possible.

All you really need is just enough gel to separate things out slightly. You can put a gate at the end of the gel and image the fluorescent activity there. One by one, based on their size, the different molecules will pass through the gate, and glow a specific color based on the base at that position. Instead of a couple hundred bases, it was now possible to get about 700 bases of sequence from a single reaction. Thanks to digital imaging, the data, an example of which is shown below, was easy to interpret. Sequences came as a computer file, ready to be plugged into various analysis programs.

The data generated by fluorescent DNA sequencing.

With all of these in place, DNA sequencing was ready to for the same sorts of processes that revolutionized many areas of technology: automation and miniaturization. Instead of a grad student or technician painstakingly adding everything that was needed into individual tubes, a robot could dispense all the reaction ingredients into a small plastic plate that could hold about 100 individual samples. A second robot could then pull the samples and deposit them into a machine that read out the sequencing information. Large gels were replaced by narrow capillaries.

The new sequencing machines could do all of this for many samples in parallel, and the larger sequencing centers had dozens of these machines. As the bottlenecks were opened wider, the human genome project shot past its planned schedule, and a flood of genomes followed.

But with the increased progress came increased expectations. Ultimately, researchers didn't just want to have a human genome, but the ability to sequence any human genome, from an individual with a genetic disease to the genome of a cancer cell, in order to personalize medicine. That, once again, has set off a race for new and exotic sequencing technology. We'll discuss the first wave of these so-called "next generation" sequencers in a future installment

adult stem cells Research

2011-05-06T19:18:00.000-07:00

Stem Cells Research Is The Future Of Medicine

History Of The Research

Stem cells have an interesting history that has been somewhat tainted with debate and controversy. In the mid 1800s it was discovered that cells were basically the building blocks of life and that some cells had the ability to produce other cells.

Attempts were made to fertilise mammalian eggs outside of the human body and in the early 1900s, it was discovered that some cells had the ability to generate blood cells.

In 1968, the first bone marrow transplant was performed to successfully treat two siblings with severe combined immunodeficiency. Other key events in stem cell research include:

1978: Stem cells were discovered in human cord blood

1981: First in vitro stem cell line developed from mice

1988: Embryonic stem cell lines created from a hamster

1995: First embryonic stem cell line derived from a primate

1997: Cloned lamb from stem cells

1997: Leukaemia origin found as haematopoietic stem cell, indicating possible proof of cancer stem cells

In 1998, Thompson, from the University of Wisconsin, isolated cells from the inner cell mass of early embryos and developed the first embryonic stem cell lines.

During that exact same year, Gearhart, from Johns Hopkins University, derived germ cells from cells in foetal gonad tissue; pluripotent stem cell lines were developed from both sources.

Then, in 1999 and 2000, scientists discovered that manipulating adult mouse tissues could produce different cell types. This meant that cells from bone marrow could produce nerve or liver cells and cells in the brain could also yield other cell types.

These discoveries were exciting for the field of stem cell research, with the promise of greater scientific control over stem cell differentiation and proliferation.

Where We Are Today?
Adult Stem cell research has now progressed dramatically and there are countless research studies published each year in scientific journals. Adult stem cells are already being used to treat many conditions such as heart disease and leukaemia.

Researchers still have a long way to go before they completely control the regulation of stem cells. The potential is overwhelmingly positive and with continued support and research, scientists will ideally be able to harness the full power of stem cells to treat diseases that you or a loved one may suffer from one day.

Cancer And Stem Cells

Cancer afflicts millions around the world each year and many go through treatment only to relapse years later. Others die from the disease and often after a great deal of suffering. It's no surprise that cancer research is at the forefront for current medical studies.

In particular stem cells are being used for cancer treatments today as well as driving current research efforts in the hopes of finding more effective cancer treatments, including the ultimate goal of a cure.

Current Stem Cell Treatments for Cancer

Adult stem cells have been used for decades to treat certain cancers through bone marrow transplants.

In this therapy, the stem cells that give rise to the different blood cells in the body are transplanted into the bone marrow of the patient, where they regenerate the blood. This is a vital and often life saving treatment because chemotherapy destroys the bone marrow alongside cancer cells and the blood cells must be replenished for the patient's treatment to be successful.

It is hoped that the molecular basis for this treatment can lead to similar treatments for other forms of cancer, allowing for cancerous tissues in areas such as the brain to receive stem cells that replenish those that are damaged through radiation.

Cancer Cell Biology

Treating cancer directly is one aim of stem cell therapy, but understanding actual cancer cell biology is another important one. In fact, it's particularly crucial because that understanding can then encourage the development of drugs and cancer specific treatments.

Some of the more recent studies have shown that cancers seem to be regularly maintained by a relatively small cluster of cancer stem cells that are able to self-renew. Scientists are trying to learn more about the genes that regulate the self-renewal feature of stem cells so that drugs can be developed to destroy the cancer stem cells.

Stem Cells and Tumours

Another important focus involves identifying and isolating cancer stem cells from tumours so that researchers can look at how cancer genes are expressed. The connection between cancer stem cells and healthy ones is also being investigated in research studies.

Stem Cell Development and Cancer

Even when cancers develop in different tissues, they can still have similar genetic abnormalities. An important scientific focus is to identify all of these genetic abnormalities and develop treatments to combat the effects.

To properly identify all of these abnormalities, however, scientists need to learn more about stem cell characteristics at the various developmental stages. By examining the developmental process of healthy stem cells, scientists can better gauge how abnormal differentiation occurs and may then be able to develop treatments to prevent or treat the abnormalities.

An understanding of how stem cell differentiation and specialization are controlled is another fundamental development process that researchers need to grasp in hopes of creating effective cancer treatments.

Because cancer rates have significantly increased over the last century and the incidence is such that even if you do not suffer from cancer in your lifetime, you will likely know someone who does, stem cell research must continue in this area.

The chance to save lives and decrease suffering is exactly the sort of motivation that should support further stem cell studies for cancer treatments.

Politics And Stem Cells

Unfortunately, politics have played a relatively large role in stem cells, which has left many people feeling powerless to influence the progress of this potential therapy.

With politics comes funding – or lack thereof – and religious and other personal views tend to get into the mix as well.

US Policies on Stem Cells

The US has changed over the years in terms of political stem cell views. In the earlier days of stem cell research, the US played a more active role.

In the last decade, however, the US has significantly fallen behind as stem cell research has continued to forge ahead in Britain and other areas around the world.

Religious Views

A key reason for the US falling 'behind' was due to the Bush administration policies on stem cell research. Many cited these policies as highly personally charged ones that were mostly impacted by strong religious and anti-abortion views.

As such, funding for embryonic stem cell research – thought to be the most promising – was virtually at a standstill.

Discarded embryos from failed in vitro fertilisation procedures became a challenge to obtain for research purposes and existing stem cell lines similarly became difficult to access.

Obama and Stem Cell Changes

Obama, the new president in the US is set to reverse the vast majority of stem cell policies that were in effect when Bush was in power.

By removing restrictions on embryonic stem cell research, he hopes to fuel the progress of US researchers into promising therapies using stem cells.

Diseases such as Alzheimer's and Parkinson's will hopefully be closer to a cure or treatments to slow their destruction. The news has been welcomed by scientists around the world as they are excited to finally access the tools needed to study stem cells while also obtaining funding to support their research efforts.

Opponents of Stem Cell Research

There are, however, opponents of the policy reversals who cite that it is unethical to use embryonic stem cells. Instead, they believe that research should focus on adult stem cells, which do not involve the destruction of am embryo

. Arguments over adult stem cells usually suggest that the quality and potential of adult stem cells is not comparable to embryonic stem cells. In this way, it is thought that embryonic stem cells are more likely to result in effective stem cell therapies for disease.

Another positive effect of the policy changes is that countries such as Britain – while committed to stem cell research everywhere in the world – are scrambling to ensure that their funding and expertise are in place to continue being a leader in stem cell research.

Science has always been fraught with competition and will continue to do so, particularly in the area of stem cell research.

Scientists in Britain want to be sure that they don't fall behind in the quest to find effective stem cell therapies. With the US set to speed ahead now, Britain may ultimately achieve greater progress with a dose of healthy competition.

Future of Stem Cell Research

For now, it looks as though the US may accelerate its stem cell research and if anything, give other countries in the world a strong challenge to continue their own research and work into advancing stem cell therapies.

Hopefully, ethical progress can continue, which can then bring treatments to the many people around the world who suffer from devastating diseases.

Stem cells can fix damaged spinal cord tissue

2011-05-06T19:01:00.000-07:00

Stem cells, along with other cells, repair damaged tissue in the mouse spinal cord, found a study by researchers at Karolinska Institutet.

The results could pave way for the development of therapies for spinal cord injury.

Scientists hope that damage to the spinal cord and brain will one day be treatable using stem cells (i.e. immature cells that can develop into different cell types).

Stem cell-like cells have been found in most parts of the adult human nervous system, although it is still unclear how much they contribute to the formation of new, functioning cells in adult individuals.

A joint study by Professor Jonas Frisen’s research group at Karolinska Institutet and their colleagues from France and Japan, shows how stem cells and several other cell types contribute to the formation of new spinal cord cells in mice and how this changes dramatically after trauma.

The research group has identified a type of stem cell, called an ependymal cell, in the spinal cord.

They show that these cells are inactive in the healthy spinal cord, and that the cell formation that takes place does so mainly through the division of more mature cells.

However, when the spinal cord is injured, these stem cells are activated to become the dominant source of new cells.

The stem cells then give rise to cells that form scar tissue and to a type of support cell that is an important component of spinal cord functionality.

The scientists also show that a certain family of mature cells known as astrocytes produce large numbers of scar-forming cells after injury.

“The stem cells have a certain positive effect following injury, but not enough for spinal cord functionality to be restored. One interesting question now is whether pharmaceutical compounds can be identified to stimulate the cells to form more support cells in order to improve functional recovery after a spinal trauma,” said Jonas Frisen.

Adult stem cells that do not age created

2011-05-06T18:58:00.000-07:00

University at Buffalo researchers have engineered adult stem cells that do not age, which means that scientists can grow them continuously in culture.

The discovery could speed development of cost-effective treatments for diseases including heart disease, diabetes, immune disorders and neurodegenerative diseases.

To create the new cell lines – named ‘MSC Universal’ – the team genetically altered mesenchymal stem cells, which are found in bone marrow and can differentiate into cell types including bone, cartilage, muscle, fat, and beta-pancreatic islet cells.

Mesenchymal stem cells have a limited life span in laboratory cultures, so scientists and doctors who use the cells in research and treatments must continuously obtain fresh samples from bone marrow donors, a process both expensive and time-consuming.

The age-less stem cells appear to function as regular mesenchymal stem cells do – including by conferring therapeutic benefits in an animal study of heart disease.

“In the case of stem cell treatments, isolating stem cells is very expensive. The cells we have engineered grow continuously in the laboratory, which brings down the price of treatments,” said Techung Lee associate professor of biochemistry and biomedical engineering in the School of Medicine and Biomedical Sciences and the School of Engineering and Applied Sciences.

Stem cells help regenerate or repair damaged tissues, primarily by releasing growth factors that encourage existing cells in the human body to function and grow.

‘Smart’ adult stem cells repair heart in ‘landmark work’

2011-05-06T18:55:00.000-07:00

In what is being touted as “landmark work”, researchers at Mayo Clinic with Belgian collaborators have demonstrated that rationally “guided” human adult stem cells can effectively heal, repair and regenerate damaged heart tissue.

Stem cells isolated from patients have normally a limited capacity to repair the heart.

This innovative technology boosts the regenerative benefit by programming adult stem cells to acquire a cardiac-like profile.

Primed by a cocktail of recombinant cardiogenic growth factors, mesenchymal stem cells (MSCs) harvested from the bone marrow of a cohort of patients with coronary artery disease showed “superior functional and structural benefit without adverse side effects” over a 1-year follow-up in a model of heart failure according to the study.

“These findings provide proof-of-principle that “smart” adult stem cells have added benefit in repairing the heart, providing the foundation for further clinical evaluation,” said Dr. Andre Terzic, Mayo Clinic researcher and senior investigator of the study.

“The successful use of guided “lineage specified” human stem cells is based on natural cardiogenic cues” added Dr. Atta Behfar, first author of the study.

The pre-clinical data reported in this seminal paper have cleared the way for safety and feasibility trials in humans, which were recently conducted in Europe.

In their editorial, Dr. Eduardo Marban, and Dr. Konstantinos Malliaras, of Cedars-Sinai Heart Institute, in Los Angeles describe the Mayo approach as a “boot camp” for stem cells and also write that the study “… provides the first convincing evidence that MSCs, at least in vitro, can in fact become functional cardiomyocytes (heart cells) …”

The long-term potential of the findings include development of an effective regenerative medicine therapy for patients with chronic heart failure.

For the study, researchers obtained bone marrow-derived stem cells from heart disease patients undergoing coronary bypass surgery.

Testing of these stem cells revealed that cells from two of 11 individuals showed an unusual capacity for heart repair.

These rare cells demonstrated upregulated genetic transcription factors that helped identify a molecular signature identifying highly regenerative stem cells.

The cardiogenic cocktail was then used to induce this signature in non-reparative patient stem cells to program their capacity to repair the heart.

Mouse models with heart failure, injected with these cells, demonstrated significant heart function recovery along with improved survival rate after a year, compared to those treated with unguided stem cells or saline.

Specifically, researchers found that the heart tissue healed more effectively; that human cardiac and vascular cells were found participating in the regeneration, repair and strengthening of heart structures within the area of injury; and that scars and vestiges of heart damage appeared to fade away.

Building and Maintaining Strong Vision for Life

2011-03-02T07:00:00.000-08:00

Building and maintaining excellent vision involves some basic steps anyone can follow. Even if you believe nothing can be done to help your vision, taking these simple steps can go far in preserving it, or even improving it.

Establishing core nutrition

The foundation of excellent vision is proper nutrition. A healthy diet is in many ways the most important factor in building, supporting, maintaining, and also improving vision. While there is no single diet that is best for everyone, experts agree that a healthy diet high in vegetables is essential for eye health. Choose to make every meal an opportunity for enjoying more vegetables (preferably organic). Steam, stir fry, or simply eat them raw.

Eat plenty of dark, green leafy vegetables like spinach, kale, collards and chard. Beyond dark greens, go for colored vegetables, including carrots (orange), squash (yellow), beets (red), and red cabbage (purple). Colors indicate phytonutrients, many of which are antioxidants and eye-specific nutrients capable of providing super nutrition for your eyes. Fruits can help vision, too. Select dark fruits that are high in antioxidants like blueberries and blackberries, as well as dried fruits like raisins and prunes.

Core supplements

A primary element in establishing core nutrition is ensuring adequate intake of essential nutrients. One of the best ways to ensure your nutrient foundation is taking a series of core nutritional supplement formulas. Core supplements include: 1) a high-quality multivitamin, 2) a vitamin C formula and 3) an essential fats formula. These three basic formulas are the first supplements you should take, even if you take no others. Taking them regularly can significantly boost your level of health.

You can find core supplements at your local health food store. Integrated Health helped pioneer the concept of core nutrition, and they have formulated a superb trio of core supplements, including Multi Two, PRO-C, and Omega Plus.

Later, after establishing your regimen of core formulas, then you can add additional formulas, including herbs, single nutrients, and specific-condition formulas (e.g., a vision formula, diabetes formula, or antioxidant formula) that meet your individual needs.

Drink carrot juice and fresh organic vegetable juices

You likely have heard that carrot juice is a tonic for the eyes. Indeed, carrot juice works extremely well for this purpose, partly by providing large amounts of provitamin-A beta-carotene. Get a quality juicer and make at least 16 oz of juice every day. If you can't make it yourself, then find a good juice bar.

While you're making carrot juice (or having it made for you), why not add some beets, parsley greens, spinach leaves, celery stalks, or cucumber pieces into the mix? Fresh vegetable juices truly are the #1 way to improve vision.

Juicers are available in a diverse array of types and models. Look at them all. There is likely one in your price range. Considering the enormous benefits, a good juicer can be a priceless tool in the quest for better vision.

Vegetable juices are excellent for hydrating your body, but also remember to drink plenty of fresh, pure water.

Take antioxidant nutrients

Antioxidants include vitamin A, vitamin C, and vitamin E. Other antioxidants needed for ocular health include beta-carotene, alpha-carotene, lycopene, and other carotenoids, such as lutein and zeaxanthin. Although multivitamins and other core formulas provide antioxidants, it is a good idea to add a specific antioxidant formula, mixed carotenes formula, or a vision formula that can provide higher levels of these nutrients for optimal eye health.

In September, a well-publicized six-year study conducted by the National Eye Institute (NEI) of the National Institutes of Health (NIH) concluded that carotenoids, including lutein and zeaxanthin are highly effective at preventing free-radical damage in eye cells and strengthening eye cell membranes (Archives of Ophthalmology 125: 1225-32, Sept. 2007). The researchers found that lutein and zeaxanthin protect the eye by absorbing blue light that can damage the macula.

NEI's study confirms what many studies have previously concluded: antioxidant carotenes powerfully protect and support eye health.

Superfoods for stronger vision

For boosting core nutrition that supports excellent vision, the best foods are superfoods. Superfoods include chlorella, spirulina, nutritional yeast, chia seeds, and other foods. Superfoods provide greater quantities of nutrients than are typically found in foods. For example, chlorella provides a large amount of chlorophyll, but also offers essential fats, nucleic acids (DNA and RNA), and vitamins.

A mixed superfood such as Rejuvenate! provides you with many superfoods, including chlorella, spirulina, nutritional yeast, and chia seeds.

Superfoods for high levels of dietary nucleic acids

Besides being dense in nutrients, one of the main reasons superfoods (especially chlorella, chlorella growth factor (CGF), and nutritional yeast) provide so much nutrition is because they contain high levels of dietary nucleic acids. Dietary nucleic acids include RNA, DNA, as well as subcomponent nucleotides and nucleosides.

Foods abundant in nucleic acids offer a unique capability for boosting the production of the energy molecule ATP (adenosine triphosphate) in the body. Nucleic acids from foods have been shown to improve energy levels, endurance, functional strength, tissue oxygenation and aerobic capacity, skin tone, and to provide many other positive benefits.

When the body abundantly produces ATP, there is energy available to carry out your genetic blueprint more accurately. This also means better intracellular communication for improved cell function, and for stimulating processes of healing, regeneration, and rejuvenation.

Dietary nucleic acids actually are so important that molecular biologist Dr. Benjamin S. Frank asserts (in Nucleic Acid Nutrition and Therapy) that nucleic acids are essential nutrients, just like vitamins and minerals. According to Dr. Frank, simply by consuming foods high in nucleic acids, we can live longer, feel better, and become younger.

The connection between improved energy (ATP) production and eye health relates to the fact that nutrients capable of supporting and regenerating tissues throughout the body can also rejuvenate eyes. When higher levels of energy produced at the cellular level (i.e., resulting from higher intakes of nucleic acids) are combined with core nutrients and antioxidants, powerful health is created for all organ systems, including eyes.

Your natural foods and supplements program will yield greater benefits for your eyes when you consume superfoods high in nucleic acids, which offer unique capacities for building health.

Reduce dietary sugars

At the same time you're increasing your intake of antioxidants, superfoods, and dietary nucleic acids, you will greatly benefit from reducing sugars in your diet, especially refined sugars. Sugars not only deplete nutrients in your body, but also contribute to the cross-linking of collagen fibers in your eye, and to aging in eyes through a biochemical process of glycation.

The result of sugar-induced glycation processes is the creation of Advanced Glycation Endproducts (AGEs), which have been implicated both in aging and age-related chronic diseases. In addition, sugars disturb blood sugar levels, which can complicate or further contribute to eye troubles.

Consume adequate amounts of essential fats

Eyes need protection afforded by essential fatty acids. Eye tissues can become dry or inflamed when they lack these fats. A core essential fats formula (see above) is important for eye health, but it is a good idea to consume additional essential fats in your diet.

Chia seeds contain an abundance of essential fats, and they also supply antioxidants. There are plenty of other sources for essential fatty acids, including nuts (e.g., walnuts) and seeds, chlorella, as well as fish and fish oils.

Try an herbal eyewash formula

For dry, irritated eyes, or eye troubles related to less than optimal circulation, try an herbal formula. Herbalists long have recommended specific herbal tinctures for eyes. For example, cayenne can powerfully boost circulation, allowing nutrients into cells and flushing out impurities.

Herbal tinctures can be taken orally, but they also can be used in very dilute form in the eyes (e.g., 2-10 drops in 1 oz distilled water).

Breathe deeply and relax

While you're following these steps for building eye health, take some time to breathe more deeply. Oxygen is the stuff of life. Oxygenated tissues have greater vitality. So if you're out getting some natural light in your eyes, and drinking carrot juice...you might take a walk and consciously breathe a little more deeply.

Ancient yogis knew well the benefits of breathing exercises and developed an entire practice (pranayama) around it. Whether or not you already practice yoga or meditation, you might set aside 8-20 minutes (or more) per day for breathing practice and deep relaxation.

Understand DNA Damage and Repair

2011-03-02T06:57:00.000-08:00

Most people today are consistently exposed to substances that are known to damage our DNA. Radiation, plastics, cigarette smoke, chemicals in soft drinks, pesticides, and many more common substances have all been found to damage our DNA. It's unfortunate because when our DNA is damaged, we subject ourselves to numerous health problems. Our cells become inhibited in producing what our bodies need and our bodies become challenged in re-growing healthy cells. Worse, the effects of our chemical habits and lifestyles are passed to our children - and our children's children. Fortunately though, our DNA has the ability to repair itself and below are a few easy ways to start your DNA on the road to repair.

Consume Chlorella
Chlorella is a chlorophyll-rich algae and it's known to help the body remove harmful substances like heavy metals, dioxins and pesticides. This is an obvious benefit because some of these substances are causing the damage in the first place. Numerous studies have found that chlorella helps our DNA repair itself - and packed with chlorophyll, chlorella adds an alkaline kick that comes in a structure that's similar to the hemoglobin of healthy blood. To add chlorella to your diet, try adding a teaspoon to fresh apple juice or a fruit smoothie each day.

Use Cat's Claw
Peruvian cat's claw is well known for its anti-inflammatory properties and is commonly used for arthritis. In Peru, cat's claw is used for cancer and it's known to help cleanse the intestinal track. Cat's claw has been repeatedly shown to help our DNA repair itself and also to prevent further damage. In one human trial, participants taking the herb for just eight weeks showed significant improvements in DNA repair.

Enjoy Enzyme-Rich Raw Foods
Gabriel Cousens, M.D., N.D. tells us that the enzymes in raw foods help our DNA repair themselves. But, because enzymes are needed for digestion and they're routinely destroyed when foods are heated, eating cooked foods robs your body of enzymes. Therefore, the more cooked foods that you eat during your lifetime, the fewer enzymes you'll have available to repair your DNA from common threats. Conversely, the more raw foods you consume, the better your body will be able to repair your DNA - as well as heal, nourish and repair your other tissues and organs.

Eat Cabbage and other Cruciferous Vegetables
Raw cabbage and other cruciferous vegetables are key for DNA repair for several reasons. First, they contain large amounts of folate - which plays an important role in cell division and DNA repair. In 2006, researchers also found that the indole-3s in cruciferous vegetables increase our body's production of BRCA1 and BRCA2 proteins - which are proteins that repair damaged DNA. These proteins are also widely acknowledged to be tumor suppressing. To boot, cruciferous vegetables contain a substance called sulforaphane which has been shown to increase our production of phase-2 detoxification enzymes. These enzymes help the body render harmless and eliminate many chemicals and toxins - so really, they help your body remove what is so often causing the problem.

Adult Stem Cell Therapy Nearing Time for Human Testing

2011-03-02T06:52:00.000-08:00

Imagine the possibilities for a moment. Doctors may soon have the ability to regrow injured muscles, tendons, and bones without resorting to surgery. All that will be needed is to inject a patient's own stem cells into the injury site.

Veterinarians are already using these techniques with injured horses and the human application of these techniques will be a reality at some point in the relatively near future.

The National Institutes for Health (NIH) has announced that they are creating a bone marrow stem cell transplant center. This center will reside within the National Institute for Arthritis and Musculoskeletal and Skin Diseases.

Scientists in NIH labs are already involved in growing human muscle, cartilage, and spinal disks in vitro. These tissues are not considered "mechanically sound" at this point, but they fully expect to reach this goal with further time and effort.

Generally, the harvesting of stem cells from human embryos is what has been getting the most media attention. Scientists have been quietly working with adult stem cells that have many of the same properties and capabilities as embryonic stem cells. These cells can also become one with their environment and they can replicate like the cells of their adopted tissue.

The projects that the NIH has been working on get some of their data from what veterinarians have learned from using adult stem cells with horse injuries. Often horses' careers have even been salvaged when stem cells were able to regrow damaged tendons and ligaments.

The healing procedure is quite simple. In a surgical room at a veterinary hospital a vet takes blood from the sternum of an injured, anesthetized horse. The vet then uses ultrasound equipment to find the exact injured areas where the stem cells need to be injected. Amazingly, in as little as a month the injured tissue will be regrown and healed.

At this point, human medicine is still fusing bone and tissue through surgical procedures. Surgery can relieve some of the pain and restore some mobility, but it does not actually repair.

Some recent studies are concluding that using a patient's own stem cells can facilitate the growth of new muscle -- whether in the knee or the heart or elsewhere. Adult stem cells called mesenchymal cells come from muscle, bone, and fat. These are cells with an amazing ability to replicate and they don't have lots of personal identity. This means that they easily take on the characteristics of any surrounding cells and they will grow quickly.

Adult stem cells are present all over the body, in bone and in marrow. They are also found in tonsils and in the placenta and umbilical cord. This suggests that it may be possible for some discarded body parts to be stored for future use.

The most positive part about using autologous cells (from a patient's own body) is that this research is not controversial like embryonic stem cell research. Also, these adult stem cells are native to a patient's own body so the chances of a patient rejecting them are almost nil.

Interestingly, doctors are already treating people with adult stem cells. Bone marrow transplants for cancer patients are essentially the same as stem cell therapy. The main difference is that the marrow usually comes from other people and the primary goal of the transplant is to boost a weakened immune system -- not to generate tissue.

Moving from animals to humans will take much more research, however. There is much more to understand about how stem cells work when injected into tissues. Veterinarians don't study horse tendons to determine how the stem cells worked to heal. Understanding is crucial to further advancements.

Stem cell therapy is not without risks, though. The worst outcome is that the stem cells will cause cancer -- or even become cancerous themselves. These are cells that want to grow so this growth has to be controlled or cancer is the likely result. If a cancerous stem cell is not identified prior to use, there will be a bad outcome.

Adult stem cells treat a host of diseases, say doctors

2011-03-02T06:50:00.000-08:00

(NaturalNews) Doctors and researchers are hailing the successes of adult stem cell treatments, which are treating everything from heart disease and diabetes, to leukemia and blindness. Adult stem cells -- the kind harvested from adult bone marrow and other tissues -- can be injected into the body to help regrow and repair organs, tissues and skin.

Unlike controversial embryonic stem cells which are harvested from aborted, human embryos, adult stem cells are extracted from living, adult humans. And based on years of experience using innovative therapy treatments, adult stem cells are proving to be highly successful in treating otherwise "incurable" diseases.

Dr. Thomas Einhorn, chairman of orthopedic surgery at Boston University Medical Center, for example, successfully used a man's pelvic bone stem cells to heal the same man's broken ankle. By drawing bone marrow from the pelvis and condensing it into an injectable liquid, Einhorn was able to spur a complete ankle healing in four months.

Then, there is the case of a patient whose damaged vision was restored after receiving adult stem cell treatment.

A recent Denver Post article explains that adult stem cells are being used to treat people with leukemia, lymphoma, heart disease, multiple sclerosis and diabetes. The possibilities are endless with adult stem cells, say numerous doctors and medical experts.

Adult stem cells can literally turn into bones, blood vessels and tissues that are diseased or damaged, and they seem to adapt to whatever is needed by the body to heal a specific area.

"That gives adult stem cells really a very interesting and potent quality that embryonic stem cells don't have," explains Rocky Tuan from the University of Pittsburgh.

Common DNA sequencing problems

2011-01-04T08:37:00.000-08:00

Suggestions for generating high quality DNA sequencing data:

DNA quality is very important, make sure the isolated DNA is free of contamination such as buffer, salt, protein, polymer, etc. Submit purified DNA in water for sequencing.
DNA quantity is very important, make sure sufficient amount of DNA is submitted for sequencing. O.D. reading tends to give false high concentration, use agarose gel electrophoresis to estimate DNA concentration.
For PCR product, please avoid polyA, polyT, di- and tri- nucleotide repeats in the region to be sequenced. There should be a minimum of 30 - 50 bp between the 3' of the sequencing primer and the start point where accurate read is needed. Also try to avoid PCR product that is less than 250 bp for sequencing as it can easily saturate the instrument detection limit as well as causing mobility shift.
Garbage in and garbage out! We use capillary electrophoresis for sequencing product separation and analysis. Any contamination that is present in the DNA and primer will end up in the final sequencing product, as it is loaded so is the contamination! Excess contamination can suppress the loading of the sequencing product causing low signal as well as a host of other ill effects. So please make efforts to generate high quality DNA and sufficient amount of DNA for sequencing.

Common DNA sequencing problems:

The sequencing reaction didn't work as shown in the following example:

Pay attention to the signal to noise ratio (S/N) on top left corner, a low value of S/N indicates that the sequencing reaction didn't work. There are several possible causes: the template doesn't have the primer binding site; the primer doesn't bind to the template; either the concentration of the template or the primer are way below optimal; or there are excess contamination either in the template or primer such as excess EDTA interfering with DNA sequencing reaction.

The sequencing reaction gave low signal as shown in the following example:

The S/N value is slightly higher. Due to the high background noise, a lot of

base calls cannot be made with certainty and the read length is short. The problem may be due to low DNA or primer concentration or excess contamination in the template or primer.

The sequencing signal gradually dropped off as shown in the example below:

In the beginning the signal is strong but it gradually tails off giving a short read length. It could be caused by excess amount of template DNA or primer; excess contamination in the template or primer; some kind of secondary structure in the template.

Excess dye terminator:

As shown below the large red and blue peaks are due to excess dye terminators from the sequencing reagents that are not completely removed during sequencing product purification process. This is due to poor ethanol wash in the purification process. It indicates that due to excess contamination either in the template or primer, the efficiency of the sequencing reaction is compromised resulting in large amount of excess sequencing reagents.

Poly T, poly A and di-nucleotide repeat. The example below is a typical sequencing pattern after polyT, polyA, and di-nucleotide repeat:

It affects PCR product sequencing more than plasmid. Therefore, keep in mind that after a repeat structure (polyA, polyT, di- or tri- nucleotide repeats) the sequencing signal will be unreadable. If you are sequencing on a template and run into a long stretch of T's or A's and the sequences become unreadable after the T or A run, we have developed two primers that can solve the problem. We have a T19V primer: TTT TTT TTT TTT TTT TTT TV (V = G, C, A), that can clean up the mess caused by a T run. (Actually we have all three primers, T19A, T19C and T19G, you can request either the specific one or the combination of all three). We also have a A19B primer: AAA AAA AAA AAA AAA AAA AB (B = G, T, C) (as you might have guessed, we have all three primers A19C, A19G and A19T), that can solve the noisy data caused by a A run.

Secondary structure:

Template that contains secondary structures such as GC rich area, inverted repeat, direct repeat and hairpins can cause the sequencing reaction to fail at the structure, unable to read through the structure as evidenced in the example below. If the secondary structure is not very strong, there are two remedies that sometimes work: use dGTP kit, this kit causes GC compression but sometimes can read through some kind of secondary structure such as weak hairpins; use SequenceRx Enhancer Solution A, this buffer helps to sequence through some secondary structures, but there is no guarantee and if it does read through it also causes compression in the area that you are interested. If you want to try these, please use the traditional format and write down your request.

Another example of secondary structure causing sudden drop of signal. The plasmid was sequenced on both strands. Panels 1 and 2 were sequenced with reverse primer (panel 1 used dGTP kit (a special kit that is supposed to read through difficult regions) while that of panel 2 was normal kit). Panels 3 and 4 showed sequencing with forward primer (panel 3 was normal kit, panel 4 used dGTP kit). Due to the presence of secondary structure (in this case, an inverted repeat region with the sequence TTTGCGGCCGAATTCGGCCGCAAA ), sequencing signal dropped suddenly at the site of secondary structure with both forward and reverse primers (panels 2 and 3). When dGTP kit was used, it sequenced through, but the repeat region is unreadable (in this case, since the repeat region is short, it is barely readable by comparing all 4 reads).

Mixture:

In this case, even though the S/N is good, the sequence is unreadable as shown in the example below. This is caused by a few specific reasons: template DNA is a mixture; template DNA has two or more binding site for the primer; primer is a mixture.

Loss of resolution:

This happens when the contaminants in the samples adversely affect the resolving power of the separation polymer used in the capillary electrophoresis system, an example is shown below:

Overloading:

When the samples are very pure and a lot are used in the sequencing rxn, they can generate huge amount of sequencing signal to overload the system so that the detection limit of the instrument is exceeded, this will cause unreadable base calls as shown in the two examples below, notice that in both cases the S/Ns are well above 1500.

Overview of molecular structure

2011-01-04T08:36:00.000-08:00

Although sometimes called "the molecule of heredity," pieces of DNA as people typically think of them are not single molecules. Rather, they are pairs of molecules, which entwine like vines to form a double helix (top half of the illustration at the right).

Each vine-like molecule is a strand of DNA: a chemically linked chain of nucleotides, each of which consists of a sugar, a phosphate and one of four kinds of aromatic "bases". Because DNA strands are composed of these nucleotide subunits, they are polymers.

The diversity of the bases means that there are four kinds of nucleotides, which are commonly referred to by the identity of their bases. These are adenine (A), thymine (T), cytosine (C), and guanine (G).

In a DNA double helix, two polynucleotide strands come together through complementary pairing of the bases, which occurs by hydrogen bonding. Each base forms hydrogen bonds readily to only one other -- A to T and C to G -- so that the identity of the base on one strand dictates what base must face it on the opposing strand. Thus the entire nucleotide sequence of each strand is complementary to that of the other, and when separated, each may act as a template with which to replicate the other (middle and lower half of the illustration at the right).

Because pairing causes the nucleotide bases to face the helical axis, the sugar and phosphate groups of the nucleotides run along the outside, and the two chains they form are sometimes called the "backbones" of the helix. In fact, it is chemical bonds between the phosphates and the sugars that link one nucleotide to the next in the DNA strand.

The role of the sequence
Within a gene, the sequence of nucleotides along a DNA strand defines a protein, which an organism is liable to manufacture or "express" at one or several points in its life using the information of the sequence. The relationship between the nucleotide sequence and the amino-acid sequence of the protein is determined by simple cellular rules of translation, known collectively as the genetic code. Reading along the "protein-coding" sequence of a gene, each successive sequence of three nucleotides (called a codon) specifies or "encodes" one amino acid.

In many species of organism, only a small fraction of the total sequence of the genome appears to encode protein. The function of the rest is a matter of speculation. It is known that certain nucleotide sequences specify affinity for DNA binding proteins, which play a wide variety of vital roles, in particular through control of replication and transcription. These sequences are frequently called regulatory sequences, and researchers assume that so far they have identified only a tiny fraction of the total that exist. "Junk DNA" represents sequences that do not yet appear to contain genes or to have a function.

Sequence also determines a DNA segment's susceptibility to cleavage by restriction enzymes, the quintessential tools of genetic engineering. The position of cleavage sites throughout an individual's genome determines one kind of an individual's "DNA fingerprint".

Stem Cell Therapy – The Miraculous Power of Modern Science

2010-10-27T06:30:00.000-07:00

Science has always surprised mankind with its innovative inventions. It has an unfolded elements of mystery in it that makes human beings curious. The field of medicine has seen recent advancements that were once considered only a dream. However, another ground breaking achievement of science is the use of stem cells in treating life threatening diseases.

The mere mention of stem cell is all enough to stir a controversy, but leaving behind everything to see the true purpose of this miraculous field of science, it is one of the greatest achievements that humans have made to establish their very existence.

Stem cells have a unique characteristic to develop themselves into many different cell types in the body. They can also repair a system without damaging other cells as long as the person lives. Stem cells have a potential to retain their abilities and remain the same or transform into another type of cell whichever serves a specific purpose like the muscle cell, a red blood cell, or a brain cell. This property of stem cell has lead modern science in to an innovative branch of medicine called “stem cell therapy”.

The stem cell therapy may be the key to many diseases that are challenging human existence. The stem cells are used to treat people who suffer from leukemia and lymphoma. So far stem cell researches have been successfully carried out to save human lives from cancer. Stem cell therapy also proves to be the answer for deadly diseases like Parkinson’s disease, schizophrenia, Alzheimer’s disease, spinal cord injuries, diabetes, and many more.

Replacement of a lost limb or any body part that is destroyed during accidents could be made possible with the recent advancements in stem cell research. Organs that have become de-generative could also be treated with the introduction of stem cells. Soon there will be a time when limbs and organs will be cultured in the lab to help organ transplants. The research holds great future in the fields of therapeutic cloning and regenerative medicine.

In case of burn victims who suffer enormous pain until the wound heals, the stem cells could be used to produce new and healthy tissues. Bone marrow transplants and blood transfusions can be successfully carried out with the help of stem cell therapy. It also facilitates us to understand the development of a human embryo to avoid birth defects, pregnancy loss and infertility in the future. Apart from this, stem cell therapy can also be used to administer the usefulness of a drug involving animal or human testers.

What Is Stem Cell Therapy?

2010-09-04T08:00:00.000-07:00

As the most basic building blocks of the human body, stem cells are characterized by their ability to differentiate and mature into other types of cells with specialized functions. They are also known for their ability to self-generate, a phenomenon where they divide and produce more stem cells. During early childhood, stem cells may develop into a variety of different cell types. They are also capable of replenishing other cells, acting as the body's own automatic repair system. This ability makes them an ideal treatment for many diseases; this treatment is called stem cell therapy.

One of the most common types of stem cell therapy is the adult stem cell transplant. This stem cell therapy is used to treat a variety of blood cancers and disorders, including leukemia, lymphoma, and multiple myeloma. This procedure can be done using bone marrow or peripheral blood stem cells.

If bone marrow is used, the marrow is harvested by extracting it from a matching donor's bones. The recipient's bone marrow is then eliminated using chemotherapy alone or a combination of chemotherapy and radiation. Then the donor's bone marrow, including the healthy stem cells, is transplanted into the recipient's system. The transplanted stem cells will then self-generate, creating healthy cells to replace the abnormal ones. A peripheral blood stem cell transplant works the same way, except the donor cells are not extracted from the bones themselves, but are harvested from stem cells circulating in the bloodstream.

Another type of stem cell therapy is the umbilical cord blood stem cell transplant. This kind of transplant works in the same manner as the bone marrow and peripheral blood stem cell transplants. The donor stem cells, however, are harvested from the blood found in the discarded umbilical cord of a newborn baby. Patients receiving this type of transplant have less risk of rejecting the stem cells than those who receive bone marrow or peripheral blood stem cell transplants. This can be attributed to the fact that these cells are so young that they have not yet matured and developed features that can be attacked in a process called host versus graft disease, where the recipient's body recognizes the donor's cells as completely foreign.

The versatility of the stem cells found in umbilical cord blood makes the possibilities endless for the future of stem cell therapy. There is ongoing research in the use of these stem cells to treat a wide range of illnesses, including neurological and cardiac diseases. Many parents choose to store their child's umbilical cord blood in special stem cell banks to use for future therapy.

State Of Stem Cells

2010-07-12T11:40:00.000-07:00

Stem cells arise after fertilization and they are capable of dividing in to any kind of cells found in the human body. These cells divide at faster rate than any other cells and are responsible for the growth of the zygote from just a mare cell to a fully grown adult. Stem cells are normally quite without any act and only spring in to action when they are needed for repair and other body functions. Stem cells are capable of self renewal; staying for long periods of time in undifferentiated state. This paper will evaluate the nature of stem cells.

Stem cells are the most important cells for human being development. Without these cells, the fertilized egg would not develop in to embryos which would in turn not develop in to adults. Stem cells are known to differentiate in to any type of cells of the human body. Unlike the specialized cells, stem cells are not functional all times. They start acting when there is need to form new cells for instance after injury. Stem cells usually divide in to two daughter cells. One of the cells can divide and specialize further to make any cell type. The other cell does not divide and remains as a stem cell to produce more cells in future when there is need. Some organs like the liver are versatile and are able to produce cells exactly like the ones in this organ.

Stem cells play a pivotal role in the development of the embryo after fertilization. When fertilization takes place, the most versatile stem cells differentiate rapidly forming the blastocyst which is ball like. The outer part of the blastocyst forms the placenta while the inner cell mass part forms all the other body tissues and organs. When isolated and grown in the laboratory, the inner mass cells are known as the embryonic stem cells. Embryonic stem cells can also be produced by in vitro fertilization in the laboratory. However, these cells do not require to be implanted in to a woman. Since there is need for continued research about stem cells, some countries made it legal to donate stem cells to research institutions. In such a scenario, a pregnant woman accepts the removal of the inner mass cells from a blastocyst.
Embryonic stem cells are of invaluable importance to scientists and researchers. Researchers can use a single embryonic stem cell to generate millions of cells which are used for many studies. This ability is based on the concept that stem cells divide but only one of the two cells differentiates and the other remains in unspecialized state and can thus divide to produce cells when there is need. Stem cells allow researchers to get a lot of information on diseases and their mechanism of action. They also get to study human body development with a lot of ease. By this researchers would be able to get cure for the many persistent diseases easily. Since stem cells are capable of differentiating to any cell type with the right chemical stimulations, they can be used for organ transplants and replacement.

Embryonic stem cells can be grown in laboratories in fertility clinics. They are usually retrieved from very young embryos during the blastocyst stage which is usually between the fourth and sixth day of pregnancy. Cells from the inner mass cells of the blastocyst are isolated and placed in laboratory dishes with all the essential nutrients. The few cells isolated are capable of dividing in to millions and millions of stem cells within a short period of time. Embryonic stem cells from a single stem cell form what is called a cell line. To make cell lines successfully, each cell has to be examined carefully to ensure that it is formed correctly with the correct number of chromosomes. Screening tests are done before the cell can be used to make cell lines.
Stem cells can be obtained from adults as well. Stem cells from adults are commonly known as tissue specific stem cells since each adult cell can only produce a limited set of specialized cells. Stem cells are located practically in every part of an adult. However, only a few of those cells can be isolated successfully. Stem cells in the bone marrow and umbilical cord are the easiest t isolate in adults. These cells are also known as hematopoietic stem cells. Hematopoietic stem cells have been used for a long time in various therapies to cure diseases such as leukemia. This is usually done through bone marrow transplantation. There are other tissue specific stem cells in an adult for instance epithelia and epidermal cells. They are hard to isolate and study because they are located deep in the tissues. Interest in these two cell types is because of their adaptation. Epidermal tissues continually repair the worn out skin tissues while the epithelia cells continually renew the gastrointestinal lining.

Tissue specific cells usually produce specialized cells. However, how they differentiate into specialized cells is not well known. Most of these cells are known to differentiate but whatever triggers their action is not known making their study limited. Injury of some of adult tissues is one of the few known stimulus of specialization of adult stem cells. Adult cells go though a number of divisions before they are fully differentiated. Progenitor cells are stem cells in an adult may lose their unspecialized ability. One amazing characteristic of stem cells is their ability to communicate with the neighboring cells. This is what is commonly known as the stem cell niche. They send and receive signals from these cells and allow them to migrate to areas that need cell division. One of the stimuli for their migration can be an injury. These cells can move to any part of the body and become any type of cell.

Stem Cells - Fundamentals

2010-07-12T11:30:00.000-07:00

A stem cell is a unique cell that can give rise to any specific specialized cell, such as a blood cell depending on the area of the body. They have the ability to divide for indefinite periods in culture and have a unique property to differentiate into any type of body cell eg nerve cell, bladder cell or muscle cell.

This unique quality of the stem cells makes them ideal for treating injury and disease by repairing or replacing damaged or diseased body cells with healthy new cells. This type of inoculation of stem cells in the area to be treated is now called stem cell transplantation.

Stem cells are used to treat degenerative diseases, which occur due to premature cell death or malfunctioning of specific cell type. Stem cells can be used to replace these dead cells.

Transplanting stem cells into the damaged area and directing them to grow into a new healthy tissue. For example heart muscle cells can be made to regenerate after a heart attack.

Stem cells that are already present in the body can be activated to produce more and new type of tissues if required.

Stem cell can also be collected, and grown in media, maintained and stored to provide healthy replacement tissue for transplantation.

BUILD A DNA MOLECULE

2010-06-02T12:04:00.000-07:00

Molecular machines copy DNA

Your body produces billions of new cells every day. Each time one of your cells divides, it must first copy the genetic information contained within its nucleus. Copying the genetic information in one cell using this activity would take more than 95 years*, yet molecular machines in your cells accomplish this feat in about 6 to 8 hours.

In order to speed up the copying process, DNA replication begins at multiple locations along each chromosome. The two DNA strands are pulled apart and copied in both directions at the rate of about 50 nucleotides per second.

Complementary base pairingThese models are based on the molecular structure of real nucleotides. The grey and white circles on the models represent partial positive and negative charges that form hydrogen bonds between complementary bases. These bonds work kind of like tiny magnets to hold the two DNA strands together. Complementary base-pairing ensures that DNA strands are copied accurately, with just a few errors for each round of replication. Forces between neighboring nucleotides stack the bases on top of one another and twist the DNA strands into a double-helix.

Benefits of DNA Testing

2010-06-02T11:47:00.000-07:00

DNA testing is a relatively new technology, but the many benefits of DNA testing have caused the use of these methods to virtually explode in a wide variety of applications. Some of the most well-known benefits of DNA testing have been seen in the arena of criminal justice. The guilty are found and convicted and the innocent are exonerated, all on the basis of microscopic evidence that nevertheless is more unique than a fingerprint. DNA fingerprinting or profiling provides a way to identify people and their relationships beyond a shadow of doubt. In many ways, it's the certainty of the DNA test results that provide the major benefits of DNA testing.One of the primary benefits of DNA testing outside of the criminal justice field is to assist women who are seeking financial support for their children. In cases where a man denies that he is the biological father, DNA paternity testing can confirm or exclude a biological relationship and allow the courts to determine whether or not he is legally responsible for child support payments.

Men who are seeking custody or visitation rights may avail themselves of the benefits of DNA testing. Again, a DNA paternity test provides a crucial confirmation of the existence of a biological relationship between father and child. This confirmation is necessary before awarding custody or visitation rights.Some men merely need to gain peace of mind regarding their relationship to a child. One of the benefits of DNA testing is being able to conclusively establish or exclude a relationship.Adopted children may someday wish to find their biological parents. DNA testing will allow them to confirm the biological relationship between themselves and their possible biological heritage.Other benefits of DNA testing include the ability to establish grandparentage and to inform decisions on inheritance rights, insurance claims or Social Security benefits. U.S. immigration officials have begun accessing the benefits of DNA testing for proving various biological relationship in foreign immigration cases.

Some of the less well-known benefits of DNA testing lie in the study of genealogy. Individuals may be interested in their ethnic origins or their ancestry. DNA testing provides clues they can pursue in search of their personal beginnings. Individuals can find if someone that shares their surname also has a biological relationship.New benefits of DNA testing include screening for genetic markers of future illness like cancer and Alzheimers Disease. The benefits of DNA testing have already begun to expand even beyond human use. Pet owners have embraced DNA testing for use in health care, breeding, and identification.

Genealogical DNA test

2010-06-02T11:29:00.000-07:00

A genealogical DNA test examines the nucleotides at specific locations on a person's DNA for genetic genealogy purposes. The test results are not meant to have any informative medical value and do not determine specific genetic diseases or disorders they are intended only to give genealogical information. Genealogical DNA tests generally involve comparing the results of living individuals to historic populations.

Procedure

The general procedure for taking a genealogical DNA test involves taking a painless cheek-scraping at home and mailing the sample to a genetic genealogy laboratory for testing. Some laboratories use mouth wash or chewing gum instead of cheek swabs. Some laboratories, such as the Human Origins Genotyping Laboratory (HOGL) at the University of Arizona, offer to store DNA samples for ease of future testing. All United States laboratories will destroy the DNA sample upon request by the customer, guaranteeing that a sample is not available for further analysis.

Types of tests

The most popular ancestry tests are Y chromosome (Y-DNA) testing and mitochondrial DNA (mtDNA) testing which test direct-line paternal and maternal ancestry, respectively. DNA tests for other purposes attempt, for example, to determine a person's comprehensive genetic make-up and/or ethnic origins.

Y chromosome (Y-DNA) testing

A man's patrilineal or direct father's-line ancestry can be traced using the DNA on his Y chromosome (Y-DNA) through Y-STR testing, as follows: This is useful because the Y chromosome, like the patrilineal surname, passes down unchanged from father to son. A man's test results are compared to another man's results to determine the time frame in which the two individuals shared a most recent common ancestor or MRCA. If their test results are a perfect or nearly perfect match, they are related within genealogy's time frame.Each person can then look at the other's father-line information, typically the names of each patrilineal ancestor and his spouse, together with the dates and places of their marriage and of both spouses' births and deaths. This information table will be referred to again within the mtDNA testing section below as the (matrilineal) "information table". The two matched persons may find a common ancestor or MRCA, as well as whatever information the other already has about their joint patriline or father's line prior to the MRCA—which might be a big help to one of them. Or if not, both keep trying to extend their father's lines further back in time. Each may choose to have their test results included in their surname's "Surname DNA project". And each receives the other's contact information if the other chose to allow this. They may correspond, and may work together in the future on joint research.
Women who wish to determine their direct paternal DNA ancestry can ask their father, brother, paternal uncle, paternal grandfather, or a cousin who shares the same surname lineage (the same Y-DNA) to take a test for them.

What gets tested
Y-DNA testing involves looking at STR segments of DNA on the Y chromosome. The STR segments which are examined are referred to as genetic markers and occur in what is considered "junk" DNA.

STR markers
A chromosome contains sequences of repeating nucleotides known as short tandem repeats (STRs). The number of repetitions varies from one person to another and a particular number of repetitions is known as an allele of the marker. An STR on the Y chromosome is designated by a DYS number (DNA Y-chromosome Segment number). The example below shows the allele of Rumpelstiltskin's DYS393 marker is 12, also called the marker's "value". The value 12 means the DYS393 sequence of nucleotides is repeated 12 times—with a DNA sequence of (AGAT)12.

SNP markers

A single-nucleotide polymorphism (SNP) is a change to a single nucleotide in a DNA sequence. The relative mutation rate for an SNP is extremely low. This makes them ideal for marking the history of the human genetic tree. SNPs are named with a letter code and a number. The letter indicates the lab or research team that discovered the SNP. The number indicates the order in which it was discovered. For example M173 is the 173rd SNP documented by the Human Population Genetics Laboratory at Stanford University, which uses the letter M.

Different Types of Stem Cells

2010-05-08T19:34:00.000-07:00

Three main types of stem cells are being investigated for their potential use in research and medicine. The cell types differ in their degree of differentiation and ability to self-renew.

In humans:

a)Embryonic stem cells come from a five to six-day-old embryo. They have the ability to form virtually any type of cell found in the human body.

b)Embryonic germ cells are derived from the part of a human embryo or foetus that will ultimately produce gametes (eggs or sperm).

c)Adult stem cells are undifferentiated cells found among specialised (differentiated) cells in a tissue or organ after birth. Based on current research, adult stem cells appear to have a more restricted ability to produce different cell types and to self-renew than embryonic stem cells.

d)Umbilical cord blood stem cells are used to treat a range of blood disorders and immune system conditions.

Stem cells that have the potential to develop into any of the cell types found in an adult Organism are called pluripotent. Embryonic stem cells are pluripotent.

Stems cells that only have the potential to make a few cell types in the body are called multipotent. Adult stem cells appear to be multipotent.

Cells that are capable of forming a completely new embryo that can develop into a new organism are called totipotent . A fertilised egg is totipotent. None of the stem cells used in research appear to have this capacity.

More basic research is required to find out how stem cells can be:
located and extracted
kept alive in the laboratory
multiplied for extended periods of time
directed to form specific types of specialised cells.

Applications of Stem Cells

2010-05-08T19:29:00.000-07:00

Stems cells – whether cord blood, adult or embryonic – have numerous applications in the areas of scientific research and cell therapy. For researchers, stem cells are the key to understanding how humans develop the way they do. Hopefully, the study of stem cells will unravel the mystery of how an undifferentiated cell is able to differentiate, and will also determine what is the signal that triggers the sequence. The greater understanding, and possibly even control, of cell division and differentiation is a significant strategy in the battle against dreaded illnesses such as cancer, which is basically the continuous multiplication of abnormal cells.

The use of stem cells for the testing of new medicines is another highly-anticipated application. Although certain cells are already utilized for this purpose – cancer cells, for example, are used to tests anti-tumor drugs – testing on pluripotent cells would open up this field to a much broader number of cell types.

The third, and possibly most important, application is cell therapy, which is the use of stem cells to produce the cells and tissues required for the renewal or repair of body organs that have been damaged by debilitating and mortal diseases such as cancer, spinal cord injuries, glaucoma, Parkinson’s, etc.

Potential uses of stem cells

2010-05-08T19:23:00.000-07:00

Stem cells have potential uses in many different areas of research and medicine, as described below. However, these applications are all likely to be 10-20 years away.

Replacing damaged tissue

Human stem cells could be used in the generation of cells and tissues for cell-based therapies. This involves treating patients by transplanting specialised cells that have been grown from stem cells in the laboratory.

Due to their ability to replace damaged cells in the body, stem cells could be used to treat a range of conditions including heart failure, spinal injuries, diabetes and Parkinson disease. Scientists hope that transplantation and growth of appropriate stem cells in damaged tissue will regenerate the various cell types of that tissue.

For example, haematopoietic stem cells (stem cells found in bone marrow) could be transplanted into patients with leukaemia to generate new blood cells. Or, neural stem cells may be able to regenerate nerve tissue damaged by spinal injury.

Studying human development

Stem cells could be used to study early events in human development and find out more about how cells differentiate and function. This may help researchers find out why some cells become cancerous and how some genetic diseases develop. This knowledge may lead to clues about how these diseases may be prevented.

Testing new drugs

Stem cells grown in the laboratory may be useful for testing drugs and chemicals before they are trialled in people. The cells could be directed to differentiate into the cell types that are important for screening that drug. These cells may be more likely to mimic the response of human tissue to the drug being tested than animal models do. This may make drug testing safer, cheaper and more ethically acceptable to those who oppose the use of animals in pharmaceutical testing.

Screening toxins

Stem cells may be useful for screening potential toxins in substances such as pesticides before they are used in the environment.
Testing gene therapy methods Stem cells may prove useful during the development of new methods for gene therapy that may help people suffering from genetic illnesses.

Adult stem cells

2010-05-08T19:16:00.000-07:00

Adult stem cells are undifferentiated cells found in tissues and organs. They are capable of self-renewal and can differentiate to form the major specialised cell types of that tissue or organ.

The main role of adult stem cells is to maintain and repair the tissue in which they are found. Skin stem cells, for example, give rise to new skin cells, ensuring that old or damaged skin cells are replenished.

It now appears that probably all tissues contain adult stem cells, but only in very small numbers. Scientists think the cells remain dormant until activated by disease or injury to that tissue. Because of their small numbers, adult stem cells have proven difficult to isolate. However, to date, adult stem cells have been derived from tissues such as the brain, bone marrow, blood, muscle, skin, pancreas and liver. Most research has been done on haematopoietic (blood forming) stem cells isolated from bone marrow and blood.

Adult stem cells appear to only generate the cell types of the tissue in which they are found. Haematopoietic stem cells, for example, are found in the bone marrow and give rise to the many types of cells found in the blood, including red and white blood cells and platelets. Bone marrow transplants have been used for more than 30 years to treat people with life-threatening blood disorders such as leukaemia and thalassaemia.

Adult stem cells are attractive as research tools and for treating disease, as they do not involve the destruction of embryos. It may also be possible to use a patient’s own stem cells to generate tissue for transplant, thus avoiding problems with immune rejection common to other types of transplantation.

However, one of the potential hurdles for the use of adult stem cells for transplants is their limited ability to generate different cell types. Recent experiments, however, have revealed that certain types of adult stem cells from one tissue may be able to generate cell types of a completely different tissue if exposed to the right conditions. This phenomenon is called plasticity. Some researchers believe that adult stem cells may be as potentially useful as embryonic stem cells in generating tissue for transplants.

Benefits of Stem Cells

2010-05-07T18:59:00.000-07:00

With all the controversy surrounding stem cells you may have missed hearing about many of the benefits for the health and medical fields. You may not even be aware that stem cells already have many applications for treating disease. Their potential to treat even more diseases in the future means that scientists are working hard to learn about how stem cells function and how they can treat some of the more serious diseases affecting the world.

Stem Cells and Human Development

Stem cells have enormous potential in health and medical research but to fully harness this potential, scientists are studying how stem cells transform, or differentiate, into the diverse range of specialised cells that make humans what they are today. Because diseases such as cancer or conditions such as birth defects are thought to occur because of problems in the differentiation process, an understanding of the development that happens in normal cells will help scientists treat the developmental errors that can occur.

Stem Cells and Cell-Based Therapies

Another potential application of stem cells is to form cells and tissues for medical therapies. Currently, it is donated organs and tissues that are substituted for damaged or dysfunctional ones. Sadly, the number of people awaiting a transplant is much higher than the number of available organs. Transplant waiting lists are enormous and many people die awaiting transplants. Stem cells offer a viable source of replacement cells to treat diseases and can potentially reduce the morbidity and mortality for those awaiting transplants. Some of the areas that stem cells can benefit include:

Parkinson's disease
Type I diabetes
Arthritis
Burn victims
Cardiovascular diseases

By directing stem cells to differentiate into specialised cell types, there is the exciting possibility to provide a renewable source of replacement cells for those suffering from diseases.

The potential to reverse diseases is also not a foreign one. For example, a patient who has suffered from a heart attack and sustained heart damage could have the damaged tissue replaced by healthy new muscle cells. The destruction of brain cells in conditions such as Parkinson's disease can hopefully be reversed with the replacement of new, healthy and functioning brain cells. Even more promising is the potential to address genetic defects that are present from birth by restoring function and health with the introduction of normal healthy cells that do not have these defects.

Burn Victims

Burn victims tend to endure an enormous amount of pain from their wounds as well as frustration from the challenges of healing. Instead of donor tissues being donated, stem cells could be used to produce new and healthy tissues. This is essentially similar to therapies already being used, such as bone marrow transplants, where stem cells create different specialised blood cells. Scientists aim to locate and remove specific stem cells from a tissue and then trigger them to differentiate outside of the body before transplanting them back into the patient to replace damaged tissues. In burn victims, a very small piece of the skin can be progressively grown, allowing doctors to cover a burn that is often much larger than the original size of the skin piece.

Stem Cells and Drug Testing

Stem cells have an important benefit for the pharmaceutical field. New drugs can be tested on stem cells to assess their safety before testing drugs on animal and human models. For example, a cancer cell line could be created to test an anti-tumour drug. If the conditions can be perfectly replicated, testing drugs could provide very accurate results.

The current benefits of stem cell usage are already well documented and it is expected that continued research will pave the way for new treatments. For those suffering from serious diseases, stem cells offer hope for effective treatment or perhaps even a reversal of the disease. Time will confirm the full success of stem cell therapies and continued research should teach us more about using stem cells to treat debilitating medical conditions.

DNA-RNA-Protein Introduction

2010-04-12T18:47:00.000-07:00

DNA carries the genetic information of a cell and consists of thousands of genes. Each gene serves as a recipe on how to build a protein molecule. Proteins perform important tasks for the cell functions or serve as building blocks. The flow of information from the genes determines the protein composition and thereby the functions of the cell.

The DNA is situated in the nucleus, organized into chromosomes. Every cell must contain the genetic information and the DNA is therefore duplicated before a cell divides (replication). When proteins are needed, the corresponding genes are transcribed into RNA (transcription). The RNA is first processed so that non-coding parts are removed (processing) and is then transported out of the nucleus (transport). Outside the nucleus, the proteins are built based upon the code in the RNA (translation).

What is DNA made of?

2010-04-12T18:26:00.000-07:00

DNA is a very large molecule, made up of smaller units called nucleotides that are strung together in a row, making a DNA molecule thousands of times longer than it is wide.

Each nucleotide has three parts: a sugar molecule, a phosphate molecule, and a structure called a nitrogenous base. The nitrogenous base is the part of the nucleotide that carries genetic information, so the words "nucleotide" and "base" are often used interchangeably. The bases found in DNA come in four varieties: adenine, cytosine, guanine, and thymine—often abbreviated as A, C, G, and T, the letters of the genetic alphabet.

How did people find out that DNA is the hereditary material?

DNA was largely ignored for decades after a German chemist, Friedrich Miescher, first isolated the white, slightly acidic substance from the nucleus of cells in 1869. No one knew what DNA's function was—in fact, some doubted that it had a function at all—so they pretty much left the stuff alone.

Very few people thought that DNA could be the hereditary material. Early studies of DNA suggested, erroneously, that the molecule was made up of the same sequence of four bases repeated over and over—ACGTACGTACGT… for example. No one could imagine how such a monotonously simple molecule could contain the information necessary to build a living organism.

But during the 1930s and 1940s, new experiments began to suggest that DNA might, in fact, be important. It turned out that different strains of bacteria can exchange DNA and that when they do certain traits, such as the ability to cause disease in humans, can be passed from one strain of bacteria to another. Scientists also learned that when a virus infects a cell it injects its DNA into the cell, which then produces many copies of the virus, suggesting that DNA contains instructions for building viruses. And they found that different species of organisms have different proportions of bases in their DNA—one species might have DNA that is 30 percent A, 20 percent C, 20 percent G, and 30 percent T, while another might have 20 percent A, 30 percent C, 30 percent G, and 20 percent T. People began to think that genetic information might be written in the differences between the DNA bases of different species.

What does DNA look like?

A DNA molecule is a double helix, a structure that looks much like a ladder twisted into a spiral. The sides of the ladder are made of alternating sugar and phosphate molecules, the sugar of one nucleotide linked to the phosphate of the next. DNA is often said to have a sugar and phosphate "backbone."

Each rung of the ladder is made of two nitrogenous bases linked together in the middle. The length of a DNA molecule is often measured in "base pairs," or bp—that is, the number of rungs in the ladder. Sometimes, this unit of measurement is shortened simply to "bases."

The structure of DNA was worked out in 1953 by James D. Watson and Francis Crick, who worked together in the Cavendish laboratory in Cambridge, England. By the time they began their work in the early 1950s, it was clear that DNA is the hereditary material, and scientists were racing to find out more about the long-ignored molecule, picking apart the implications of each new detail. Everyone knew they couldn't really understand how DNA works until they understood how its nucleotide building blocks are put together.
When Watson and Crick joined the race, they were supposed to be investigating the structure of proteins. But they were both convinced that DNA was a more important molecule, and they shared a passionate interest in finding out its structure. Like kids hiding comic books inside a copy of Moby Dick, they snuck away from their protein work to think about DNA whenever they could.
While many other discoveries about DNA had emerged from laboratory experiments, Watson and Crick relied mainly on abstract thinking. They synthesized all the information that had been gathered about DNA, throwing out what was contradictory and trying to imagine a structure that would be consistent with as many pieces of known information as possible.
Watson and Crick also liked to play with toys. Specifically, they played with ball-and-stick molecular models to gain an understanding of how nucleotides might fit together in three dimensions. They put models together and took them apart, drew molecular diagrams on paper and scratched them out. Eventually, when they hit on the idea of the double helix, everything else they knew about DNA seemed to fall into place.
For example, they realized that if sugar and phosphate molecules formed the sides of the ladder, then any sequence of bases could form the rungs of the ladder, and genetic information could be encoded in the order of the bases. They also realized that the ladder would only fit together if the rungs were formed by specific pairs of bases. Specifically, A must always pair with T, and C with G. Any other combination and the sides of the ladder would be too far apart or too close together. This helped explain why, although the amount of each base can vary from species to species, the amounts of A and T are always equal, as are the amounts of C and G.

In other words, the order of bases on one DNA strand, or side of the ladder, determines the bases on the other side of the ladder. Thus, DNA sequences are often written as if DNA were only single-stranded: AGTCTGGAT…. Scientists need sequence only one DNA strand in order to know the sequence of both strands.

Biological function in DNA

2010-04-02T22:37:00.000-07:00

DNA usually occurs as linear chromosomes in eukaryotes, and circular chromosomes in prokaryotes. The set of chromosomes in a cell makes up its genome; the human genome has approximately 3 billion base pairs of DNA arranged into 46 chromosomes. The information carried by DNA is held in the sequence of pieces of DNA called genes. Transmission of genetic information in genes is achieved via complementary base pairing. For example, in transcription, when a cell uses the information in a gene, the DNA sequence is copied into a complementary RNA sequence through the attraction between the DNA and the correct RNA nucleotides. Usually, this RNA copy is then used to make a matching protein sequence in a process called translation which depends on the same interaction between RNA nucleotides. Alternatively, a cell may simply copy its genetic information in a process called DNA replication. The details of these functions are covered in other articles; here we focus on the interactions between DNA and other molecules that mediate the function of the genome.

Genes and genomes

Genomic DNA is located in the cell nucleus of eukaryotes, as well as small amounts in mitochondria and chloroplasts. In prokaryotes, the DNA is held within an irregularly shaped body in the cytoplasm called the nucleoid. The genetic information in a genome is held within genes, and the complete set of this information in an organism is called its genotype. A gene is a unit of heredity and is a region of DNA that influences a particular characteristic in an organism. Genes contain an open reading frame that can be transcribed, as well as regulatory sequences such as promoters and enhancers, which control the transcription of the open reading frame.

In many species, only a small fraction of the total sequence of the genome encodes protein. For example, only about 1.5% of the human genome consists of protein-coding exons, with over 50% of human DNA consisting of non-coding repetitive sequences. The reasons for the presence of so much non-coding DNA in eukaryotic genomes and the extraordinary differences in genome size, or C-value, among species represent a long-standing puzzle known as the "C-value enigma." However, DNA sequences that do not code protein may still encode functional non-coding RNA molecules, which are involved in the regulation of gene expression.

Some non-coding DNA sequences play structural roles in chromosomes. Telomeres and centromeres typically contain few genes, but are important for the function and stability of chromosomes. An abundant form of non-coding DNA in humans are pseudogenes, which are copies of genes that have been disabled by mutation. These sequences are usually just molecular fossils, although they can occasionally serve as raw genetic material for the creation of new genes through the process of gene duplication and divergence.

Transcription and translation

A gene is a sequence of DNA that contains genetic information and can influence the phenotype of an organism. Within a gene, the sequence of bases along a DNA strand defines a messenger RNA sequence, which then defines one or more protein sequences. The relationship between the nucleotide sequences of genes and the amino-acid sequences of proteins is determined by the rules of translation, known collectively as the genetic code. The genetic code consists of three-letter 'words' called codons formed from a sequence of three nucleotides .

In transcription, the codons of a gene are copied into messenger RNA by RNA polymerase. This RNA copy is then decoded by a ribosome that reads the RNA sequence by base-pairing the messenger RNA to transfer RNA, which carries amino acids. Since there are 4 bases in 3-letter combinations, there are 64 possible codons . These encode the twenty standard amino acids, giving most amino acids more than one possible codon. There are also three 'stop' or 'nonsense' codons signifying the end of the coding region; these are the TAA, TGA and TAG codons.

Replication

Cell division is essential for an organism to grow, but when a cell divides it must replicate the DNA in its genome so that the two daughter cells have the same genetic information as their parent. The double-stranded structure of DNA provides a simple mechanism for DNA replication. Here, the two strands are separated and then each strand's complementary DNA sequence is recreated by an enzyme called DNA polymerase. This enzyme makes the complementary strand by finding the correct base through complementary base pairing, and bonding it onto the original strand. As DNA polymerases can only extend a DNA strand in a 5′ to 3′ direction, different mechanisms are used to copy the antiparallel strands of the double helix. In this way, the base on the old strand dictates which base appears on the new strand, and the cell ends up with a perfect copy of its DNA.

What is DNA ?

2010-04-02T22:32:00.000-07:00

DNA is a nucleic acid that contains the genetic instructions used in the development and functioning of all known living organisms and some viruses. The main role of DNA molecules is the long-term storage of information. DNA is often compared to a set of blueprints or a recipe, or a code, since it contains the instructions needed to construct other components of cells, such as proteins and RNA molecules. The DNA segments that carry this genetic information are called genes, but other DNA sequences have structural purposes, or are involved in regulating the use of this genetic information.

Chemically, DNA consists of two long polymers of simple units called nucleotides, with backbones made of sugars and phosphate groups joined by ester bonds. These two strands run in opposite directions to each other and are therefore anti-parallel. Attached to each sugar is one of four types of molecules called bases. It is the sequence of these four bases along the backbone that encodes information. This information is read using the genetic code, which specifies the sequence of the amino acids within proteins. The code is read by copying stretches of DNA into the related nucleic acid RNA, in a process called transcription.

Within cells, DNA is organized into long structures called chromosomes. These chromosomes are duplicated before cells divide, in a process called DNA replication. Eukaryotic organisms store most of their DNA inside the cell nucleus and some of their DNA in organelles, such as mitochondria or chloroplasts. In contrast, prokaryotes store their DNA only in the cytoplasm. Within the chromosomes, chromatin proteins such as histones compact and organize DNA. These compact structures guide the interactions between DNA and other proteins, helping control which parts of the DNA are transcribed.

Stem Cells: The Future Of Medicine

2010-03-04T19:18:00.001-08:00

One day in the not too distant future, modern medicine will change completely, and stem cells will be used to treat and cure serious conditions that as of right now are still considered untreatable and irreversible. We will not even need doctors anymore. Every time something goes wrong, you will just pop offer to your local gene therapy clinic to get a tune-up with some freshly grown injectable stem cells engineered to cure your latest malady.

Stem cells are undifferentiated, non-specific human cells with a full complement of DNA that have not yet transformed into anything specific, such as the cells in your hand, or the cells in your hair follicles. These cells are capable of being a mechanic for your body; they can repair you by undergoing cell division to manufacture whatever cells are needed in order to replace old, damaged, or diseased cells that are no longer viable and need to be replenished.

Stem cell lines, once isolated, are very easy for scientists to work with because they can continue to make these cells for testing from the original line, due to the fact that those original lines are basically immortal, providing scientists with an unlimited supply that they can use for experimentation.

Currently, stem cell treatments are not available for most conditions and are usually only utilized in bone marrow transplants and not much else. The primary challenge that researchers face, as they attempt to perfect the usage of these treatments, is to prevent the immune system of the patient from rejecting the injected cells. A similar dilemma occurs with organ transplants, as the immune system of the recipient can reject the donation.

There have been a few successful, high risk experiments that utilized stem cells to reverse a debilitating condition. One of the most noteworthy examples occurred within the past 2 years, as scientists injected cells into the area where a test patient had been suffering from acute arthritis, and the results were astonishing. The cells divided into healthy joint cells that integrated themselves into the inflamed area and reversed the arthritic condition.

Stem cells will ultimately be the final frontier of medicine, providing cures for diseases that scientists have struggled with for years, such as Alzheimers, heart disease, and organic brain disease. However, there is much opposition to the research. Prominent religious leaders and idealogues are opposed to the research.

The religious right feels that creating an embryo to do research is tantamount to abortion. However, if the research is to reach its full potential, the creation of further embryos will be a necessity in order to support adequate research.

What Is Stem Cell Therapy?

2010-03-04T19:16:00.000-08:00

Cord Blood and Stem Cells

2010-03-04T19:10:00.000-08:00

There has been a lot of talk in the news recently about the positive benefits of retaining cord blood, and the need to invest time and money in stem cell research.

Cord Blood is the blood that remains in the umbilical cord and placenta following birth. Generally, cord blood is routinely discarded with the placenta and umbilical cord at the time of birth, but now research has shown that the blood in the cord is a rich source of stem cells. This is very important as stem cells are the building blocks of the blood and the immune system.

It has become apparent that saving the cord blood in blood banks, could save the life of the donor, or members of their family from future diseases. This is possible because stem cells have the ability to differentiate into other types of cells in the body, and thus give rise to all the tissues, organs and systems in the body. By saving these stem cells, treatments can be developed for diseases such as Parkinson's, Alzheimers and Diabetes - to name but a few.

The stems cells in a child's cord blood are genetically unique to the baby and its biological family. As a valuable biological resource, researchers can use these stems cells to investigate the potential for future applications, should the child or family develop health problems later in life. This has brought about the current trend for many parents to invest in their own 'health insurance' by storing the stem cells retained at birth in cord blood banks.

The process of storing the cord blood, involves drawing the blood from the umbilical cord, using either the syringe or bag collection method, after the umbilical cord has been clamped and cut. The blood is then tested to determine whether it meets eligibility standards. The red blood cells or plasma are removed as they will not be needed in transplantation. The blood is then stored in the cord blood unit - either in a vinyl or plastic bag in which it is frozen in liquid nitrogen.

There are two types of cord blood banks...

First, there are the family banks, which store the umbilical cord for one's own family use.

Second, there are the public donor banks, which store the blood for unrelated or non-family use - this can be used for research and development of cures for many types of health problems.

Every parent has the option of saving their baby's cord blood for their family use, however, only a small number of people become eligible to donate their baby's cord blood stem cells.

There are three sources of stem cells in the body.

1 - Cells from bone marrow.

2 - Cells from peripheral blood (this is the blood that circulates through the body).

3 - Cells from umbilical cord blood.

The umbilical blood is significant for research because it differs from the other types of stem cells. Due to the structure of the stem cells in the cord blood, they are less likely to be rejected by the body when used in a transplant. This allows for the use of the blood in patients other than the original donor and results in a higher rate of success.

The Secret About Adult Stem Cells

2010-03-04T19:08:00.000-08:00

Most people have heard something about stem cells. Unfortunately most of it is regarding embryonic stem cells which are highly controversial and have sparked an ethical debate. Adult stem cells on the other hand are naturally present in the bone marrow and have been there since birth. These stem cells are the body's natural renewal system and scientific studies have shown that the more we have circulating in our bloodstream, the greater our health and wellness.

In what's regarded as a major scientific breakthrough, a peer-reviewed clinical study has proven that a patented concentrate of AFA (aphanizomenon flos-aquae) extract showed an increase of 25% in the number of circulating stem cells after 1 hour.

This study presents great hope as the body uses stem cells to create new cells in the tissues and organs in the constant process of renewal. This AFA concentrate supports the body's ability to rebuild and repair. The addition of millions of stem cells in the blood stream could very well be the most important wellness breakthrough of our times.

Everyone can benefit from this AFA concentrate from younger people to the elderly. It is also tremendous for those who engage in sports, regardless if they are professional athletes or weekend amateurs. Athletes have a great need for recovery and renewal and boosting the body's natural process allows them to remain in optimal condition.

A great example of this is an athlete in the 65 years age category competing at the US masters games. He ran a mile in five minutes 12 seconds which shattered a 35-year-old record. He was taking the AFA concentrate and credits it for this and his other gold-medal performances. Many athletes have blasted through strength training plateaus as well. Optimal athletic performance requires optimal renewal and an increase number of circulating stem cells will help the body to do this.

With all the research pointing towards adult stem cells as being the most helpful, this clinically proven AFA concentrate is the safe and natural way to engage the body's natural system of renewal.

What are Stem Cells?

2010-03-04T18:56:00.000-08:00

Stem cells are a class of undifferentiated cells that are able to differentiate into specialized cell types. Commonly, stem cells come from two main sources:

Embryos formed during the blastocyst phase of embryological development (embryonic stem cells) and
Adult tissue (adult stem cells).

Both types are generally characterized by their potency, or potential to differentiate into different cell types (such as skin, muscle, bone, etc.).

Adult stem cells

Adult or somatic stem cells exist throughout the body after embryonic development and are found inside of different types of tissue. These stem cells have been found in tissues such as the brain, bone marrow, blood, blood vessels, skeletal muscles, skin, and the liver. They remain in a quiescent or non-dividing state for years until activated by disease or tissue injury.

Adult stem cells can divide or self-renew indefinitely, enabling them to generate a range of cell types from the originating organ or even regenerate the entire original organ. It is generally thought that adult stem cells are limited in their ability to differentiate based on their tissue of origin, but there is some evidence to suggest that they can differentiate to become other cell types.

Embryonic stem cells

Embryonic stem cells are derived from a four- or five-day-old human embryo that is in the blastocyst phase of development. The embryos are usually extras that have been created in IVF (in vitro fertilization) clinics where several eggs are fertilized in a test tube, but only one is implanted into a woman.

Sexual reproduction begins when a male's sperm fertilizes a female's ovum (egg) to form a single cell called a zygote. The single zygote cell then begins a series of divisions, forming 2, 4, 8, 16 cells, etc. After four to six days - before implantation in the uterus - this mass of cells is called a blastocyst. The blastocyst consists of an inner cell mass (embryoblast) and an outer cell mass (trophoblast). The outer cell mass becomes part of the placenta, and the inner cell mass is the group of cells that will differentiate to become all the structures of an adult organism. This latter mass is the source of embryonic stem cells - totipotent cells (cells with total potential to develop into any cell in the body).

In a normal pregnancy, the blastocyst stage continues until implantation of the embryo in the uterus, at which point the embryo is referred to as a fetus. This usually occurs by the end of the 10th week of gestation after all major organs of the body have been created.

However, when extracting embryonic stem cells, the blastocyst stage signals when to isolate stem cells by placing the "inner cell mass" of the blastocyst into a culture dish containing a nutrient-rich broth. Lacking the necessary stimulation to differentiate, they begin to divide and replicate while maintaining their ability to become any cell type in the human body. Eventually, these undifferentiated cells can be stimulated to create specialized cells.

Stem cell cultures

Stem cells are either extracted from adult tissue or from a dividing zygote in a culture dish. Once extracted, scientists place the cells in a controlled culture that prohibits them from further specializing or differentiating but usually allows them to divide and replicate. The process of growing large numbers of embryonic stem cells has been easier than growing large numbers of adult stem cells, but progress is being made for both cell types.

Stem cell lines

Once stem cells have been allowed to divide and propagate in a controlled culture, the collection of healthy, dividing, and undifferentiated cells is called a stem cell line. These stem cell lines are subsequently managed and shared among researchers. Once under control, the stem cells can be stimulated to specialize as directed by a researcher - a process known as directed differentiation. Embryonic stem cells are able to differentiate into more cell types than adult stem cells.

Potency

Stem cells are categorized by their potential to differentiate into other types of cells. Embryonic stem cells are the most potent since they must become every type of cell in the body. The full classification includes:

Totipotent - the ability to differentiate into all possible cell types. Examples are the zygote formed at egg fertilization and the first few cells that result from the division of the zygote.
Pluripotent - the ability to differentiate into almost all cell types. Examples include embryonic stem cells and cells that are derived from the mesoderm, endoderm, and ectoderm germ layers that are formed in the beginning stages of embryonic stem cell differentiation.
Multipotent - the ability to differentiate into a closely related family of cells. Examples include hematopoietic (adult) stem cells that can become red and white blood cells or platelets.
Oligopotent - the ability to differentiate into a few cells. Examples include (adult) lymphoid or myeloid stem cells.
Unipotent - the ability to only produce cells of their own type, but have the property of self-renewal required to be labeled a stem cell. Examples include (adult) muscle stem cells.

Embryonic stem cells are considered pluripotent instead of totipotent because they do not have the ability to become part of the extra-embryonic membranes or the placenta.

Identification of stem cells

Although there is not complete agreement among scientists of how to identify stem cells, most tests are based on making sure that stem cells are undifferentiated and capable of self-renewal. Tests are often conducted in the laboratory to check for these properties.

One way to identify stem cells in a lab, and the standard procedure for testing bone marrow or hematopoietic stem cell (HSC), is by transplanting one cell to save an individual without HSCs. If the stem cell produces new blood and immune cells, it demonstrates its potency.

Clonogenic assays (a laboratory procedure) can also be employed in vitro to test whether single cells can differentiate and self-renew. Researchers may also inspect cells under a microscope to see if they are healthy and undifferentiated or they may examine chromosomes.

To test whether human embryonic stem cells are pluripotent, scientists allow the cells to differentiate spontaneously in cell culture, manipulate the cells so they will differentiate to form specific cell types, or inject the cells into an immunosuppressed mouse to test for the formation of a teratoma (a benign tumor containing a mixture of differentiated cells).

Research with stem cells

Scientists and researchers are interested in stem cells for several reasons. Although stem cells do not serve any one function, many have the capacity to serve any function after they are instructed to specialize. Every cell in the body, for example, is derived from first few stem cells formed in the early stages of embryological development. Therefore, stem cells extracted from embryos can be induced to become any desired cell type. This property makes stem cells powerful enough to regenerate damaged tissue under the right conditions.

Organ and tissue regeneration

Tissue regeneration is probably the most important possible application of stem cell research. Currently, organs must be donated and transplanted, but the demand for organs far exceeds supply. Stem cells could potentially be used to grow a particular type of tissue or organ if directed to differentiate in a certain way. Stem cells that lie just beneath the skin, for example, have been used to engineer new skin tissue that can be grafted on to burn victims.

Brain disease treatment

Additionally, replacement cells and tissues may be used to treat brain disease such as Parkinson's and Alzheimer's by replenishing damaged tissue, bringing back the specialized brain cells that keep unneeded muscles from moving. Embryonic stem cells have recently been directed to differentiate into these types of cells, and so treatments are promising.

Cell deficiency therapy

Healthy heart cells developed in a laboratory may one day be transplanted into patients with heart disease, repopulating the heart with healthy tissue. Similarly, people with type I diabetes may receive pancreatic cells to replace the insulin-producing cells that have been lost or destroyed by the patient's own immune system. The only current therapy is a pancreatic transplant, and it is unlikely to occur due to a small supply of pancreases available for transplant.

Blood disease treatments

Adult hematopoietic stem cells found in blood and bone marrow have been used for years to treat diseases such as leukemia, sickle cell anemia, and other immunodeficiencies. These cells are capable of producing all blood cell types, such as red blood cells that carry oxygen to white blood cells that fight disease. Difficulties arise in the extraction of these cells through the use of invasive bone marrow transplants. However hematopoietic stem cells have also been found in the umbilical cord and placenta. This has led some scientists to call for an umbilical cord blood bank to make these powerful cells more easily obtainable and to decrease the chances of a body's rejecting therapy.

General scientific discovery

Stem cell research is also useful for learning about human development. Undifferentiated stem cells eventually differentiate partly because a particular gene is turned on or off. Stem cell researchers may help to clarify the role that genes play in determining what genetic traits or mutations we receive. Cancer and other birth defects are also affected by abnormal cell division and differentiation. New therapies for diseases may be developed if we better understand how these agents attack the human body.

Another reason why stem cell research is being pursued is to develop new drugs. Scientists could measure a drug's effect on healthy, normal tissue by testing the drug on tissue grown from stem cells rather than testing the drug on human volunteers.

Stem cell controversy

The debates surrounding stem cell research primarily are driven by methods concerning embryonic stem cell research. It was only in 1998 that researchers from the University of Wisconsin-Madison extracted the first human embryonic stem cells that were able to be kept alive in the laboratory. The main critique of this research is that it required the destruction of a human blastocyst. That is, a fertilized egg was not given the chance to develop into a fully-developed human.

When does life begin?

The core of this debate - similar to debates about abortion, for example - centers on the question, "When does life begin?" Many assert that life begins at conception, when the egg is fertilized. It is often argued that the embryo deserves the same status as any other full grown human. Therefore, destroying it (removing the blastocyst to extract stem cells) is akin to murder. Others, in contrast, have identified different points in gestational development that mark the beginning of life - after the development of certain organs or after a certain time period.

Chimeras

People also take issue with the creation of chimeras. A chimera is an organism that has both human and animal cells or tissues. Often in stem cell research, human cells are inserted into animals (like mice or rats) and allowed to develop. This creates the opportunity for researchers to see what happens when stem cells are implanted. Many people, however, object to the creation of an organism that is "part human".